BIOCHEMICALS

Voigt Global Distribution LLC offers an enormous selection of biochemicals for use in the educational and research community. PRODUCTS ARE NOT EXPORTED FROM THE USA. Please check the availability of your product by selecting the first letter of your required biochemical below. Send us an inquiry via e-mail and include the part number. We will provide you cost, shipping requirements, potential hazard information and other general information upon request!

Notice: Voigt Global Distribution LLC is solely responsible for the data contained herein and the associated correctness and validity of any data provided.

Click here to go to our home page to review chemicals, scientific instruments, food ingredients, molecular biology supplies and moreClick here to send us e-mail about biochemicals

Send us an inquiry via e-mail and include the part number!

We will provide cost, shipping requirements, potential hazard information and other information upon request!

Catalog Number Catalog Name
PC01CB c-Abl (Ab-1) Polyclonal Antibody 
OP19CB Anti-c-Abl (Ab-2) (Mouse) 
OP19LCB Anti-c-Abl (Ab-2) (Mouse) 
OP19LCB c-Abl (Ab-2) Monoclonal Antibody 
OP19CB c-Abl (Ab-2) Monoclonal Antibody 
OP20CB Anti-c-Abl (Ab-3) (Mouse) 
OP20TCB Anti-c-Abl (Ab-3) (Mouse) 
OP20TCB c-Abl (Ab-3) Monoclonal Antibody 
OP20CB c-Abl (Ab-3) Monoclonal Antibody 
112251CB C-AGP 
216200CB C-ATR 
227021CB C-C Chemokine Receptor 1 (7-24) Blocking Peptide, Human 
227020CB C-C Chemokine Receptor 1 (7-24) Polyclonal Antibody 
227020CB Anti-C-C Chemokine Receptor 1 (7-24), Human (Rabbit) 
PC04CB c-ErbB2-c-Neu (Ab-1) Polyclonal Antibody 
OP14CB Anti-c-ErbB2-c-Neu (Ab-2) (Mouse) 
OP14LCB Anti-c-ErbB2-c-Neu (Ab-2) (Mouse) 
OP14TCB Anti-c-ErbB2-c-Neu (Ab-2) (Mouse) 
OP14LCB c-ErbB2-c-Neu (Ab-2) Monoclonal Antibody 
OP14TCB c-ErbB2-c-Neu (Ab-2) Monoclonal Antibody 
OP14CB c-ErbB2-c-Neu (Ab-2) Monoclonal Antibody 
OP15CB Anti-c-ErbB2-c-Neu (Ab-3) (Mouse) 
OP15LCB Anti-c-ErbB2-c-Neu (Ab-3) (Mouse) 
OP15TCB Anti-c-ErbB2-c-Neu (Ab-3) (Mouse) 
OP15FCB Anti-c-ErbB2-c-Neu (Ab-3) (Mouse) Fluorescein Conjugate 
OP15CB c-ErbB2-c-Neu (Ab-3) Monoclonal Antibody 
OP15LCB c-ErbB2-c-Neu (Ab-3) Monoclonal Antibody 
OP15TCB c-ErbB2-c-Neu (Ab-3) Monoclonal Antibody 
OP15FCB c-ErbB2-c-Neu (Ab-3) Monoclonal Antibody Fluorescein Conjugate 
OP16CB Anti-c-ErbB2-c-Neu (Ab-4) (Mouse) 
OP16LCB Anti-c-ErbB2-c-Neu (Ab-4) (Mouse) 
OP16LCB c-ErbB2-c-Neu (Ab-4) Monoclonal Antibody 
OP16CB c-ErbB2-c-Neu (Ab-4) Monoclonal Antibody 
OP39CB Anti-c-ErbB2-c-Neu (Ab-5) (Mouse) 
OP39CB c-ErbB2-c-Neu (Ab-5) Monoclonal Antibody 
OP67CB c-ErbB2-c-Neu (Ab-6) Monoclonal Antibody 
OP82CB c-ErbB2-c-Neu (Ab-7) Monoclonal Antibody 
PC27LCB c-ErbB3 (Ab-1) Polyclonal Antibody 
OP119CB Anti-c-ErbB3 (Ab-4) (Mouse) 
OP119CB c-ErbB3 (Ab-4) Monoclonal Antibody 
OP120CB Anti-c-ErbB3 (Ab-5) (Mouse) 
OP120CB c-ErbB3 (Ab-5) Monoclonal Antibody 
OP121CB Anti-c-ErbB4 (Ab-1) (Mouse) 
OP121CB c-ErbB4 (Ab-1) Monoclonal Antibody 
OP122CB c-ErbB4 (Ab-2) Monoclonal Antibody 
OP17LCB Anti-c-Fos (Ab-1) (Mouse) 
OP17CB Anti-c-Fos (Ab-1) (Mouse) 
OP17CB c-Fos (Ab-1) Monoclonal Antibody 
OP17LCB c-Fos (Ab-1) Monoclonal Antibody 
PC05TCB Anti-c-Fos (Ab-2) (Rabbit) 
PC05TCB c-Fos (Ab-2) Polyclonal Antibody 
PC05CB c-Fos (Ab-2) Polyclonal Antibody 
PC05LCB c-Fos (Ab-2) Polyclonal Antibody 
OP53CB c-Fos (Ab-3) Monoclonal Antibody 
OP54CB c-Fos (Ab-4) Monoclonal Antibody 
PC38TCB Anti-c-Fos (Ab-5) (Rabbit) 
PC38TCB c-Fos (Ab-5) Polyclonal Antibody 
PC38CB c-Fos (Ab-5) Polyclonal Antibody 
OP23LCB c-H-Ras (Ab-1) Monoclonal Antibody 
OP23TCB c-H-Ras (Ab-1) Monoclonal Antibody 
OP23CB c-H-Ras (Ab-1) Polyclonal Antibody 
553329CB c-H-Ras, GST•Tag™, Human, Recombinant, E. coli 
553330CB c-H-Ras, His•Tag®, Human, Recombinant, E. coli 
420103CB c-Jun (1-79)-GST, Human, Recombinant, E. coli 
420110CB c-Jun (Ser63), Phospho-Specific Polyclonal Antibody 
420110CB Anti-c-Jun (Ser63), Phospho-Specific, Human (Rabbit) 
420111CB Anti-c-Jun (Ser73),Phospho-Specific , Human (Rabbit) 
420111CB c-Jun (Ser73),Phospho-Specific Polyclonal Antibody 
420105CB c-Jun N-Terminal Kinase, Rat, Recombinant, E. coli 
PC452CB Anti-c-Jun Terminal Kinase 
PC06CB c-Jun-AP-1 (Ab-1) Polyclonal Antibody 
PC06LCB c-Jun-AP-1 (Ab-1) Polyclonal Antibody 
PC07CB c-Jun-AP-1 (Ab-2) Polyclonal Antibody 
PC07LCB c-Jun-AP-1 (Ab-2) Polyclonal Antibody 
OP55CB c-Jun-AP-1 (Ab-3) Monoclonal Antibody 
OP56LCB Anti-c-Jun-AP-1 (Ab-4) (Mouse) 
OP56LCB c-Jun-AP-1 (Ab-4) Monoclonal Antibody 
OP24CB c-K-Ras (Ab-1) Monoclonal Antibody 
OP24LCB c-K-Ras (Ab-1) Monoclonal Antibody 
OP24TCB c-K-Ras (Ab-1) Monoclonal Antibody 
218150CB Anti-c-Kit 
PC34CB c-Kit (Ab-1) Polyclonal Antibody 
OP10CB Anti-c-Myc (Ab-1) (Mouse) 
OP10TCB Anti-c-Myc (Ab-1) (Mouse) 
OP10LCB Anti-c-Myc (Ab-1) (Mouse) 
OP10LCB c-Myc (Ab-1) Monoclonal Antibody 
OP10TCB c-Myc (Ab-1) Monoclonal Antibody 
OP10CB c-Myc (Ab-1) Monoclonal Antibody 
OP10FCB c-Myc (Ab-1) Monoclonal Antibody Fluorescein Conjugate 
OP30CB Anti-c-Myc (Ab-2) (Mouse) 
OP30LCB Anti-c-Myc (Ab-2) (Mouse) 
OP30LCB c-Myc (Ab-2) Monoclonal Antibody 
OP30CB c-Myc (Ab-2) Monoclonal Antibody 
OP31CB Anti-c-Myc (Ab-3) (Mouse) 
OP31LCB Anti-c-Myc (Ab-3) (Mouse) 
OP31LCB c-Myc (Ab-3) Monoclonal Antibody 
OP31CB c-Myc (Ab-3) Monoclonal Antibody 
OP103CB Anti-c-Myc (Ab-4) (Mouse) 
OP103CB c-Myc (Ab-4) Monoclonal Antibody 
475962CB c-myc Antisense Oligonucleotide, Fluorescein-Labeled, Sodium Salt 
475961CB c-myc Antisense Oligonucleotide, Negative Control, Sodium Salt 
475959CB c-myc Antisense Oligonucleotide, Sodium Salt 
475961CB c-myc NS 
475959CB c-myc AS 
OP25CB c-N-ras (Ab-1) Monoclonal Antibody 
OP25LCB c-N-Ras (Ab-1) Monoclonal Antibody 
C-265CB C-Peptide 33-63 
C-265CB C-PEPTIDE FRAGMENT 33-63 
235752CB C-Reactive Protein Polyclonal Antibody 
235752CB Anti-C-Reactive Protein, Human (Rabbit) 
236600CB C-Reactive Protein, Human Ascites 
236603CB C-Reactive Protein, Human Serum, High Purity 
236608CB C-Reactive Protein, Human, Recombinant, E. coli 
322400CB C-TAK1 Polyclonal Antibody 
PC31CB Anti-c-Trk (Ab-1) (Rabbit) 
PC31CB c-Trk (Ab-1) Polyclonal Antibody 
204873CB C1, Human 
234363CB C1-Esterase Inhibitor Polyclonal Antibody 
204883CB C1-Esterase Inhibitor, Human 
234363CB Anti-C1-Esterase Inhibitor, Human (Goat) 
205525CB C10E6 
205526CB C10E8 
205524CB C12E5 
205527CB C12E6 
205528CB C12E8 
205529CB C12E9 
234390CB C1q Polyclonal Antibody 
204876CB C1q, Human 
234390CB Anti-C1q, Human (Goat) 
234401CB C1q-Depleted Serum, Human 
204878CB C1r, Human, Activated, Two-Chain Form 
234359CB C1s Polyclonal Antibody 
234359CB Anti-C1s, Human (Goat) 
204879CB C1s, Human, Activated, Two-Chain Form 
204882CB C2, Human 
234365CB Anti-C2, Human (Goat) 
234402CB C2-Depleted Serum, Human 
324875CB C20:5 w-3 
341273CB C3 Activator Convertase 
341262CB C3 Proactivator 
204885CB C3, Human 
204869CB Anti-C3, Human (Goat) 
234403CB C3-Depleted Serum, Human 
204884CB C3a des-Arg, Human 
204881CB C3a, Human 
204859CB Anti-C3a, Human (Rabbit) 
204860CB C3b, Human 
341280CB C3b-C4b Inactivator 
204866CB C3c, Human 
204870CB C3d, Human 
234380CB Anti-C4 Binding Protein, Human (Rabbit) 
204886CB C4, Human 
204894CB Anti-C4, Human (Goat) 
234404CB C4-Deficient Serum, Guinea Pig 
204887CB C4a, Human 
204897CB C4b, Human 
204888CB C5, Human 
800311CB Anti-C5, Human (Rabbit) 
234405CB C5-Depleted Serum, Human 
204902CB C5a des-Arg, Human 
204900CB C5a, Human 
204889CB Anti-C5a, Human, (Rabbit) 
204906CB C5b,6 Complex, Human 
204903CB Anti-C5b-9, Human (Rabbit) 
204890CB C6, Human 
204891CB Anti-C6, Human (Goat) 
234406CB C6-Depleted Serum, Human 
479824CB C6-NBD-SM 
204892CB C7, Human 
204893CB Anti-C7, Human (Goat) 
234407CB C7-Depleted Serum, Human 
204896CB C8, Human 
204904CB Anti-C8, Human (Goat) 
204898CB Anti-C8, Human (Rabbit) 
234408CB C8-Depleted Serum, Human 
204910CB C9, Human 
204912CB Anti-C9, Human (Goat) 
234409CB C9-Depleted Serum, Human 
205535CB CA 1001 
209925CB CA 125 
209926CB CA 125 
209915CB CA 15-3 
209920CB CA 19-9 
209922CB CA 19-9 
209930CB CA 72-4 
205530CB CA-074 
205531CB CA-074 Me 
NB12CB Ca2+-Calmodulin Kinase II a-Subunit (Ab-1) Monoclonal Antibody 
PC304CB CA150 (Ab-1) Polyclonal Antibody 
208690CB Ca2+-Calmodulin 
NB13CB Ca2+-Calmodulin Kinase II a-Subunit-Phosphorylated (Ab-2) Monoclonal Antibody 
208711CB Ca2+-Calmodulin Kinase II Inhibitor 281-309 
208699CB Ca2+-Calmodulin Kinase II Substrate 
5-23-4910CB Ca2+-Calmodulin Kinase II Substrate 
208708CB Ca2+-Calmodulin Kinase II Substrate 281-291 
208706CB Ca2+-Calmodulin Kinase II, a-Subunit, Rat, Recombinant 
208703CB Ca2+-Calmodulin Kinase II, N-Terminal (7-20) Polyclonal Antibody 
208703CB Anti-Ca2+-Calmodulin Kinase II, N-Terminal (7-20), Rat (Rabbit) 
208707CB Ca2+-Calmodulin Kinase II, Rat Brain 
208691CB Ca2+-Calmodulin Kinase IV (127-143) Polyclonal Antibody 
208714CB Ca2+-Calmodulin Kinase IV, C-Terminal (465-474) Blocking Peptide, Rat 
208709CB Ca2+-Calmodulin Kinase IV, C-Terminal (465-474) Polyclonal Antibody 
208709CB Anti-Ca2+-Calmodulin Kinase IV, C-Terminal (465-474), Rat (Rabbit) 
208720CB Ca2+-Calmodulin Kinase Kinase, C-Terminal (490-503) Blocking Peptide, Rat 
208717CB Ca2+-Calmodulin Kinase Kinase, C-Terminal (490-503) Polyclonal Antibody 
208717CB Anti-Ca2+-Calmodulin Kinase Kinase, C-Terminal (490-503), Rat (Rabbit) 
209915CB CAA-B 
209920CB CAA-GI 
209922CB CAA-Gl 
209925CB CAA-O 
209926CB CAA-O 
206500CB CaBP-9k 
207555CB CaC 
GR28LCB Anti-Cachectin 
GF31CB Anti-Cachectin 
654245CB rm-Cachectin 
208290CB CaCl2 
208291CB CaCl2, 2H2O 
205541CB Cacodylic Acid, Sodium Salt 
114664CB Cactinomycin 
205543CB CAD (205-221) Polyclonal Antibody 
205543CB Anti-CAD (205-221), Mouse (Rabbit) 
PC412CB Anti-CAD (Ab-1) (Rabbit) 
PC412TCB Anti-CAD (Ab-1) (Rabbit) 
PC412CB CAD (Ab-1) Polyclonal Antibody 
PC412TCB CAD (Ab-1) Polyclonal Antibody 
239100CB cADPR 
CC31TCB Anti-CAF-1 (p150) (Ab-2) (Mouse) 
CC31CB CAF-1 (p150) (Ab-2) Monoclonal Antibody 
CC31TCB CAF-1 (p150) (Ab-2) Monoclonal Antibody 
CC36CB Anti-CAF-1 (p150) (Ab-3) (Mouse) 
CC36CB CAF-1 (p150) (Ab-3) Monoclonal Antibody 
205500CB CAFdA 
205546CB Caffeic Acid 
211200CB Caffeic Acid Phenethyl Ester, Synthetic 
205548CB Caffeine 
70216CB CAGDOWN primer 
130132CB Caged g-Aminobutyric Acid 
189110CB Caged Aspartic Acid, Sodium Salt 
119127CB Caged ATP, Disodium Salt 
116810CB Caged cAMP 
370657CB Caged cGMP 
130132CB Caged GABA, Sodium Salt 
351015CB Caged Glutamic Acid, Sodium Salt 
407133CB Caged GPIP2, Trisodium Salt 
371710CB Caged GTP, Disodium Salt 
407135CB Caged Ins(1,4,5)P3, Trisodium Salt 
70214CB CAGUP primer 
207002CB CAIN Polyclonal Antibody 
206700CB CAL-AM 
PC253LCB Anti-Calbindin D-28K (Ab-1) (Rabbit) 
PC253LCB Calbindin D-28K (Ab-1) Polyclonal Antibody 
206500CB Calbindin-D9k, Porcine Intestine 
206550CB CALBIOSORB™ Adsorbent 
206552CB CALBIOSORB™ Adsorbent, Prepacked Columns 
206564CB CalbioTag™ 2-Aminobenzoic Acid Glycan Labeling Kit 
206700CB Calcein-acetoxymethyl Ester, Diacetate 
206700CB Calcein-AM 
207555CB Calcicludine, Dendroaspis angusticeps 
100105CB Calcimycin 
539530CB Anti-Calcineurin 
539568CB Calcineurin 
207005CB Calcineurin Assay Kit, Colorimetric 
207000CB Calcineurin Autoinhibitory Peptide 
PC359CB Anti-Calcineurin B (Ab-1) (Rabbit) 
PC359CB Calcineurin B (Ab-1) Polyclonal Antibody 
539531CB Calcineurin Blocking Peptide 
207007CB Calcineurin Cellular Activity Assay Kit, Colorimetric 
207008CB Calcineurin Substrate 
208274CB Calciseptine, Dendroaspis polylepis polylepis 
PC205LCB Anti-Calcitonin Gene Related Peptide (CGRP) (Ab-1) (Rabbit) 
PC205LCB Calcitonin Gene Related Peptide (CGRP) (Ab-1) Polyclonal Antibody 
5-23-2407CB Calcitonin Gene-Related Peptide-I 8-37, Human 
5-23-2404CB Calcitonin Gene-Related Peptide-I, Human 
5-23-2405CB Calcitonin Gene-Related Peptide-II, Human 
5-23-2402CB Calcitonin, Human 
5-23-2401CB Calcitonin, Salmon 
679101CB Calcitriol 
208290CB Calcium Chloride, Dihydrate 
208291CB Calcium Chloride, Dihydrate, Molecular Biology Grade 
69592CB Calf Liver tRNA 
208665CB Calmidazolium Chloride 
208734CB Calmodulin antagonist 
208734CB Calmodulin Binding Domain 
208735CB Calmodulin Inhibitory Peptide 
208736CB Calmodulin Inhibitory Peptide, Control 
208917CB Calmodulin Kinase IIa Antisense Oligonucleotide, Sodium Salt 
208919CB Calmodulin Kinase IIa Antisense Oligonucleotide, Sodium Salt, Fluorescein-Labeled 
208918CB Calmodulin Kinase IIa Antisense Oligonucleotide, Sodium Salt, Negative Control 
208696CB Calmodulin Monoclonal Antibody 
208693CB Calmodulin Monoclonal Antibody 
208692CB Calmodulin Polyclonal Antibody 
208697CB Calmodulin, Biotinylated, Bovine Brain 
208690CB Calmodulin, Bovine Brain 
208694CB Calmodulin, Bovine Brain, High Purity 
208692CB Anti-Calmodulin, Bovine Testes (Sheep) 
208698CB Calmodulin, Human Brain 
208702CB Calmodulin, Immobilized, Bovine Brain 
208880CB Calnexin, C-Terminal (575-593) Polyclonal Antibody 
208880CB Anti-Calnexin, C-Terminal (575-593), Canine (Rabbit) 
208882CB Calnexin, N-Terminal (50-68) Polyclonal Antibody 
208882CB Anti-Calnexin, N-Terminal (50-68), Canine (Rabbit) 
KS01LCB Calpactin I - p36 (Ab-1) Monoclonal Antibody 
KS01LCB Anti-Calpactin I - p36 (Ab-1), Human (Mouse) 
KS02LCB Calpactin II - p35 (Ab-1) Monoclonal Antibody 
KS02LCB Anti-Calpactin II - p35 (Ab-1), Human (Mouse) 
208715CB m-Calpain 
208727CB Anti-Calpain I, Domain II, Bovine (Mouse) 
208728CB Calpain I, Domain III Monoclonal Antibody 
208728CB Anti-Calpain I, Domain III, Bovine (Mouse) 
208713CB Calpain I, Human Erythrocytes 
208732CB Calpain I, Large Subunit Polyclonal Antibody 
208732CB Anti-Calpain I, Large Subunit, Human (Rabbit) 
208712CB Calpain I, Porcine Erythrocytes 
208737CB Calpain II (Domain III) Polyclonal Antibody 
208737CB Anti-Calpain II (Domain III), Rat (Rabbit) 
208729CB Calpain II, Domains III-IV Monoclonal Antibody 
208729CB Anti-Calpain II, Domains III-IV, Bovine (Mouse) 
208715CB Calpain II, Porcine Kidney 
208718CB Calpain II, Rat, Recombinant, High Purity, E. coli 
208719CB Calpain Inhibitor I 
208721CB Calpain Inhibitor II 
208722CB Calpain Inhibitor III 
208724CB Calpain Inhibitor IV 
208733CB Calpain Inhibitor Set 
208726CB Calpain Inhibitor V 
208745CB Calpain Inhibitor VI 
433698CB Calpain Inhibitor VII 
208738CB Calpain LP82-LP85 Polyclonal Antibody 
208739CB Calpain LP85 Polyclonal Antibody 
208723CB Calpain Substrate I, Fluorogenic 
208731CB Calpain Substrate II, Fluorogenic 
208729CB Anti-m-Calpain, Domains III-IV 
208905CB Calpastatin Monoclonal Antibody 
208902CB Calpastatin Peptide 
208904CB Calpastatin Peptide, Negative Control 
208903CB Calpastatin, Domain IV Monoclonal Antibody 
208903CB Anti-Calpastatin, Domain IV, Bovine (Mouse) 
208905CB Anti-Calpastatin, Human (Mouse) 
208901CB Calpastatin, Human Erythrocytes 
208900CB Calpastatin, Human, Recombinant, Domain I 
03-34-0051CB Calpeptin 
208725CB Calphostin C, Cladosporium cladosporioides 
208910CB Calreticulin (405-417) Polyclonal Antibody 
208910CB Anti-Calreticulin (405-417), Human (Rabbit) 
208912CB Anti-Calreticulin, Human (Mouse) 
PC254LCB Anti-Calretinin (Ab-1) (Rabbit) 
PC254LCB Calretinin (Ab-1) Polyclonal Antibody 
PC629CB Calretinin (Ab-2) Polyclonal Antibody 
208915CB Calsequestrin Polyclonal Antibody 
208915CB Anti-Calsequestrin, Canine (Rabbit) 
208851CB Calyculin A, Discodermia calyx 
208698CB CaM 
208693CB Anti-CaM 
208694CB CaM 
208696CB Anti-CaM 
208690CB CaM 
208917CB CaM KIIa AS 
208918CB CaM KIIa AS, Control 
208919CB CaM KIIa AS, FAM 
208706CB CaM Kinase II 
208707CB CaM Kinase II 
208734CB CaM kinase II 290-309 
208710CB CaM Kinase II Inhibitor 281-301 
208711CB CaM Kinase II Inhibitor 281-309 
208708CB CaM Kinase II Substrate 281-291 
208703CB Anti-CaMK II 
208709CB Anti-CaMK IV 
208717CB Anti-CaMKK 
116820CB Anti-cAMP (Rabbit) 
539231CB Anti-cAMP Dependent Protein Kinase 
116811CB cAMP Direct Immunoassay Kit, Colorimetric 
116820CB cAMP Polyclonal Antibody 
116801CB cAMP, Na 
116803CB cAMP-AM 
PC455CB Anti-cAMP-Responsive Element Binding Protein 
390238CB Camptothecin, 10-Hydroxy-, Camptotheca acuminata 
208925CB Camptothecin, Camptotheca acuminata 
539568CB CaN 
2090CB L-Canavanine Sulfate, Canavalia ensiformis 
209915CB Cancer Associated Antigen, Breast Tumor, Human Fluids 
209920CB Cancer Associated Antigen, Gastrointestinal Tumor, Human Fluids 
209922CB Cancer Associated Antigen, Gastrointestinal Tumor, Human, Cell Culture-Derived 
209926CB Cancer Associated Antigen, Ovarian Tumor, Cell Culture-Derived 
209925CB Cancer Associated Antigen, Ovarian Tumor, Human Fluids 
209930CB Cancer Associated Antigen, TAG-72, Human Fluids 
235260CB Anti-Cancer Osaka Thyroid Protein Kinase 
PC241CB Cannabinoid Receptor CB1 (Ab-1) Polyclonal Antibody 
209550CB Cannabinoid Receptor CB1 Polyclonal Antibody 
216401CB Cannabinoid Receptor CB1 Polyclonal Antibody 
209552CB Cannabinoid Receptor CB2 Polyclonal Antibody 
209554CB Cannabinoid Receptor CB2 Polyclonal Antibody 
216407CB Cannabinoid Receptor CB2 (20-33) Polyclonal Antibody 
210150CB Cantharidic Acid 
210155CB Cantharidin 
AM46CB Anti-CAP4 
AM46TCB Anti-CAP4 
PC349CB Anti-CAP4 
PC349TCB Anti-CAP4 
PC335CB Anti-CAP4 
PC335TCB Anti-CAP4 
QIA71CB CAP4 Assay 
211200CB CAPE 
487915CB CapNO 
494415CB Caprylic Acid 
239782CB CAPS, ULTROL® Grade 
PC420CB Anti-Capsaicin Receptor (Ab-1) (Rabbit) 
PC420CB Capsaicin Receptor (Ab-1) Polyclonal Antibody 
PC547CB Anti-Capsaicin Receptor (Ab-2) (Rabbit) 
PC547TCB Anti-Capsaicin Receptor (Ab-2) (Rabbit) 
PC547CB Capsaicin Receptor (Ab-2) Polyclonal Antibody 
PC547TCB Capsaicin Receptor (Ab-2) Polyclonal Antibody 
211280CB Capsazepine 
211875CB Captopril 
212385CB Carbachol 
212402CB Carbacyclic PGI2 
212402CB Carbacyclin 
666122CB Carbamide 
212385CB Carbamoylcholine Chloride 
69101CB Carbenicillin 
205805CB Carbenicillin, Disodium Salt 
66612CB Carbimide 
474790CB Carbobenzoxy-L-leucyl-L-leucyl-L-leucinal 
474780CB Carbobenzoxy-L-leucyl-L-leucyl-L-norvalinal 
208722CB Carbobenzoxy-valinyl-phenylalaninal 
215363CB Carbohydrate Affinity Resin, Gala-Agarose 
215366CB Carbohydrate Affinity Resin, Galb-Agarose 
215364CB Carbohydrate Affinity Resin, Gala1,3Gal-Agarose 
215365CB Carbohydrate Affinity Resin, Gala1,4Gal-Agarose 
215361CB Carbohydrate Affinity Resin, GalNAca-Agarose 
215362CB Carbohydrate Affinity Resin, GalNAcb-Agarose 
215360CB Carbohydrate Affinity Resin, N-Acetyllactosamine-Agarose 
215410CB Carbohydrate Plate 
215411CB Carbohydrate Plate 
215406CB Carbohydrate Plate 
215407CB Carbohydrate plate 
215408CB Carbohydrate Plate 
215409CB Carbohydrate Plate 
215401CB Carbohydrate Plate, a-D-Gal 
215402CB Carbohydrate Plate, b-D-Gal 
215401CB Carbohydrate Plate, a-D-Galactopyranoside 
215402CB Carbohydrate Plate, b-D-Galactopyranoside 
215403CB Carbohydrate Plate, a-D-GalNAc 
215404CB Carbohydrate Plate, b-D-GalNAc 
215405CB Carbohydrate Plate, b-D-GlcNAc 
215409CB Carbohydrate Plate, b-Lactose 
215410CB Carbohydrate Plate, a-Neu5Ac 
215404CB Carbohydrate Plate, 2-Acetamido-2-deoxy-b-D-galactopyranoside 
215403CB Carbohydrate Plate, 2-Acetamido-2-deoxy-a-D-galactopyranoside 
215405CB Carbohydrate Plate, 2-Acetamido-2-deoxy-b-D-glucopyranoside 
215406CB Carbohydrate Plate, Globotetraose 
215407CB Carbohydrate Plate, Globotriose 
215408CB Carbohydrate Plate, GM3 
215400CB Carbohydrate Plate, N-Acetyl (Blank) 
215411CB Carbohydrate Plate, Sialyl Lewis x 
516725CB Carbolic Acid 
215755CB Carbonic Anhydrase, Bovine Erythrocytes 
215911CB Carbonyl Cyanide m-Chlorophenylhydrazone 
66612CB Carbonyl Diamide 
666122CB Carbonyl Diamide 
480420CB 4,4',4'',4'''-[Carbonyl-bis[imino-5,1,3-benzenetriyl bis-(carbonylimino)]]tetrakis-(benzene-1,3-disulfonic Acid, 8Na) 
480415CB 8,8'-[Carbonylbis(imino-3,1-phenylene)]bis-(1,3,5-naphthalenetrisulfonic Acid), 6Na 
216100CB Carboplatin 
420318CB 2-Carboxy-4-(1-methylethenyl)-3-pyrrolidineacetic Acid 
217385CB Carboxy-PTIO 
217418CB Carboxy-SNAFL Indicator 
216200CB Carboxyatractyloside, Atractylis gummifera 
421050CB 1,3-di-(N-Carboxybenzoyl-L-leucyl-L-leucyl)amino Acetone 
217370CB (2S,1'S,2'S)-2-(Carboxycyclopropyl)glycine 
580560CB tris(2-Carboxyethyl)phosphine, HCl 
345645CB 2-(2-Carboxyethylthio)-ethyl b-D-galactopyranoside 
345816CB 2-(2-Carboxyethylthio)-ethyl 2-acetamido-2-deoxy-a-D-galactopyranoside 
345817CB 2-(2-Carboxyethylthio)-ethyl 2-acetamido-2-deoxy-b-D-galactopyranoside 
427504CB 2-(2-Carboxyethylthio)-ethyl, 4-O-(b-D-galactopyranosyl)-b-D-glucopyranoside 
345644CB 2-(2-Carboxyethylthio)-propyl a-D-galactopyranoside 
216295CB DL-g-Carboxyglutamic Acid, Monoammonium Salt 
01-64-0238CB Carboxymethanethiol 4-methoxytrityl resin 
540210CB 4-(Carboxymethoxy)phenacyl Br 
164590CB Carboxymethoxylamine, Hemihydrochloride 
364200CB N-[(2R)-2-(Carboxymethyl)-4-methylpentanoyl]-L-tryptophan-(S)-methyl-benzylamide 
551828CB 2-{[2-bis(Carboxymethyl)amino-5-methylphenoxy]methyl}-6-methoxy-8-bis(carboxymethyl)aminoquinoline tetrakis(acetoxymethyl) Ester 
217274CB Carboxymethylcellulose, Sodium Salt, High Viscosity 
217277CB Carboxymethylcellulose, Sodium Salt, Low Viscosity 
344900CB 1-[2-(5-Carboxyoxazol-2-yl)-6-aminobenzofuran-5-oxy]-2-(2'-amino-5'-methylphenoxy)-ethane-N,N,N',N'-tetraacetic Acid, 5Na 
344905CB 1-[2-(5-Carboxyoxazol-2-yl)-6-aminobenzofuran-5-oxy]-2-(2'-amino-5'-methylphenoxy)-ethane-N,N,N'N'-tetraacetic Acid Pentaacetoxymethyl Ester 
217286CB Carboxypeptidase A, Bovine Pancreas 
217356CB Carboxypeptidase B, Porcine Pancreas 
217359CB Carboxypeptidase Inhibitor, Potato 
217373CB Carboxypeptidase W, Wheat 
217372CB Carboxypeptidase Y, Excision Grade, Yeast 
01-64-0378CB Carboxypolystyrene EHL (100-200 mesh), 1% DVB 
01-64-0111CB Carboxypolystyrene HL (100-200 mesh), 1% DVB 
01-64-0150CB Carboxypolystyrene VHL (100-200 mesh), 1% DVB 
586116CB 8-(3-Carboxypropyl)-1,3-dimethylxanthine Lactam 
586116CB 8-(3-Carboxypropyl)theophylline Lactam 
345890CB 2-(2-Carboxytheylthio)-ethyl 2-acetamido-2-deoxy-b-D-glucopyranoside 
345897CB 2-(2-Carboxythylthio)-ethyl 4-O-[4-O(a-D-galacto-2-nonulopyranosyl)-b-D-galactopyranosyl]-b-D-glucopyranoside 
219369CB Carcinoembryonic Antigen, Human Colon Adenocarcinoma Cell Line 
219368CB Carcinoembryonic Antigen, Human Tumor 
217450CB Anti-Cardiac Type a1c, Rabbit (Rabbit) 
217504CB Cardiotoxin, Naja nigricollis 
218200CB Cardiotrophin-1, Human, Recombinant, E. coli 
217525CB L-Carnitine 
217535CB Carnosol, Rasmarinus officinals 
218387CB CART (55-102), Human 
218388CB CART (55-102), Rat 
218300CB CART Polyclonal Antibody 
218300CB Anti-CART, Mouse (Rabbit) 
208274CB CaS 
218700CB Casein Kinase I (321-337) Polyclonal Antibody 
218700CB Anti-Casein Kinase I (321-337), Human (Rabbit) 
218730CB Casein Kinase I Substrate 
218731CB Casein Kinase II Substrate 
231576CB Anti-Casein Kinase II Substrate, Phospho-Specific (Mouse) 
231576CB Casein Kinase II Substrate, Phospho-Specific Monoclonal Antibody 
218703CB Casein Kinase II, a-Subunit Monoclonal Antibody 
231575CB Casein Kinase II, a-Subunit (70-89) Blocking Peptide, Human 
231573CB Casein Kinase II, a-Subunit (70-89) Polyclonal Antibody 
231573CB Anti-Casein Kinase II, a-Subunit (70-89), Human (Rabbit) 
218712CB Casein Kinase II, b-Subunit Monoclonal Antibody 
218712CB Anti-Casein Kinase II, b-Subunit, Human (Mouse) 
218711CB Casein Kinase II, b-Subunit, Human, Recombinant, E. coli 
218704CB Casein Kinase II, a-Subunit, Human, Recombinant, E. coli 
218707CB Casein Kinase II, a-Subunit, Zea mays, Recombinant, E. coli 
218701CB Casein Kinase II, Human, Recombinant, E. coli 
218698CB Casein Kinase II, Human, Recombinant, E. coli 
218680CB Casein, Bovine Milk 
218682CB Casein, Bovine Milk, Carbohydrate and Fatty Acid Free 
311511CB Casein, N,N-Dimethyl-, Bovine 
218693CB Casein, Resorufin-Labeled 
573464CB Casein, Succinyl- 
21859CB Casein, Vitamin-Free, Bovine 
218681CB Casein-Yellow, Bovine 
343006CB Anti-CASH 
343002CB Anti-CASHa Anti-CASH 
218715CB CASK (578-592) Polyclonal Antibody 
218715CB Anti-CASK (578-592), Human (Rabbit) 
PP55CB CASP1 
PP59CB CASP1 
PP60CB CASP1 
PC84CB Anti-CASP1 
PC80LCB Anti-CASP1 
PC81LCB Anti-CASP1 
PC82LCB Anti-CASP1 
PC83CB Anti-CASP1 
PC79CB Anti-CASP1 
PC350TCB CASP10 
PC332TCB CASP10 
PC445CB Anti-CASP11 
PC379CB Anti-CASP11 
PC107CB Anti-CASP2 
AM65CB Anti-CASP3 
AM34TCB Anti-CASP3 
AM39CB Anti-CASP3 
AM39TCB Anti-CASP3 
AM20CB Anti-CASP3 
AM20TCB Anti-CASP3 
AM34CB Anti-CASP3 
WBB27CB CASP3 Biotinylated Western Blotting System 
PC109CB Anti-CASP4 
AM38CB Anti-CASP4 
AM38TCB CASP4 
PC416CB Anti-CASP6 
PC365CB Anti-CASP6 
PC422CB Anti-CASP7 
PC334CB Anti-CASP7 
PC334TCB CASP7 
AM45TCB CASP7 
AM46CB Anti-CASP8 
AM46TCB Anti-CASP8 
PC335CB Anti-CASP8 
PC335TCB Anti-CASP8 
PC349CB Anti-CASP8 
PC349TCB Anti-CASP8 
QIA71CB CASP8 Assay 
PC475CB Anti-CASP9 
PC336CB Anti-CASP9 
AM47CB Anti-CASP9 
AM47TCB CASP9 
218794CB Anti-CASP9 
QIA72CB CASP9 Assay 
PC412CB Anti-Caspase Activated DNAse 
PC412TCB Caspase Activated DNAse 
205543CB Anti-Caspase Activated DNase 
235416CB Caspase Active Site Peptide 
218816CB Caspase Enzymes Set, Group I 
218817CB Caspase Enzymes Set, Group II 
218819CB Caspase Enzymes Set, Group III 
218812CB Caspase Family Enzyme Set I, Human, Recombinant, E. coli 
QIA78CB Caspase Flow Cytometric Apoptosis Assay Kit 
627610CB Caspase Inhibitor I 
218742CB Caspase Inhibitor I, Biotin Conjugate 
218830CB Caspase Inhibitor I, Cell-Permeable 
218735CB Caspase Inhibitor II 
218745CB Caspase Inhibitor III 
218784CB Caspase Inhibitor IV 
235429CB Caspase Inhibitor Set I 
218772CB Caspase Inhibitor Set II 
218806CB Caspase Inhibitor Set III 
218825CB Caspase Inhibitor Set IV 
219000CB Caspase Inhibitor V, Biotin Conjugate 
219007CB Caspase Inhibitor VI 
218726CB Caspase Inhibitor VII 
218729CB Caspase Inhibitor VIII 
218827CB Caspase Inhibitor, Fluorogenic 
342000CB Caspase Inhibitor, Negative Control 
ASK22CB CARD (Caspase Recruitment Domain) Sampler Kit 
ASK24CB DED (Death Effector Domain) Caspase Sampler Kit 
218743CB Caspase Substrate I, Fluorogenic 
218780CB Caspase Substrate Set I, Colorimetric 
218782CB Caspase Substrate Set II, Fluorogenic 
218808CB Caspase Substrate Set III, Colorimetric 
218809CB Caspase Substrate Set IV, Fluorogenic 
218734CB Caspase-1 Assay Kit 
218790CB Caspase-1 Assay Kit, Colorimetric 
218791CB Caspase-1 Assay Kit, Fluorometric 
400010CB Caspase-1 Inhibitor I 
400011CB Caspase-1 Inhibitor I, Cell-Permeable 
400012CB Caspase-1 Inhibitor II 
400022CB Caspase-1 Inhibitor II, Biotin Conjugate 
400024CB Caspase-1 Inhibitor III, Biotin Conjugate 
400015CB Caspase-1 Inhibitor IV 
400019CB Caspase-1 Inhibitor V 
218746CB Caspase-1 Inhibitor VI 
218786CB Caspase-1 Inhibitor VII, Biotin Conjugate 
218727CB Caspase-1 Inhibitor VIII 
PP55CB Caspase-1a Peptide 
PP59CB Pan Caspase-1 Peptide 
PP60CB Pro Caspase-1 Peptide 
400016CB Caspase-1 Substrate I 
400018CB Caspase-1 Substrate II, Fluorogenic 
400020CB Caspase-1 Substrate III, Fluorogenic 
400025CB Caspase-1 Substrate IV, Colorimetric 
218738CB Caspase-1 Substrate IX, Fluorogenic 
400017CB Caspase-1 Substrate V, Fluorogenic 
688225CB Caspase-1 Substrate VI, Fluorogenic 
218736CB Caspase-1 Substrate VII, Colorimetric 
218737CB Caspase-1 Substrate VIII, Fluorogenic 
218739CB Caspase-1 Substrate X, Fluorogenic 
218795CB Caspase-1 Substrate XI, Fluorogenic 
218796CB Caspase-1 Substrate XI, Standard 
688224CB Caspase-1 Substrate XII, Fluorogenic 
218821CB Caspase-1 Substrate XIII, Water-Soluble, Colorimetric 
218822CB Caspase-1 Substrate XIV, Water-Soluble, Colorimetric 
PC79CB Caspase-1a (Ab-1) Polyclonal Antibody 
PC80LCB Caspase-1b (Ab-1) Polyclonal Antibody 
PC82LCB Caspase-1e (Ab-1) Polyclonal Antibody 
PC81LCB Caspase-1g Polyclonal Antibody 
218783CB Caspase-1, Human, Recombinant, E. coli 
400005CB Caspase-1-Caspase-4 Substrate I, Fluorogenic 
400006CB Caspase-1-Caspase-4 Substrate II, Fluorogenic 
400007CB Caspase-1-Caspase-4 Substrate III, Colorimetric 
400008CB Caspase-1-Caspase-4 Substrate IV, Colorimetric 
PC332TCB Anti-Caspase-10 (Ab-1) (Rabbit) 
PC332CB Anti-Caspase-10 (Ab-1) (Rabbit) 
PC332TCB Caspase-10 (Ab-1) Polyclonal Antibody 
PC332CB Caspase-10 (Ab-1) Polyclonal Antibody 
PC350TCB Anti-Caspase-10 (Ab-2) (Rabbit) 
PC350CB Anti-Caspase-10 (Ab-2) (Rabbit) 
PC350CB Caspase-10 (Ab-2) Polyclonal Antibody 
PC350TCB Caspase-10 (Ab-2) Polyclonal Antibody 
218810CB Caspase-10 Assay Kit, Colorimetric 
218811CB Caspase-10 Assay Kit, Fluorometric 
218771CB Caspase-10, C-Terminal (505-521) Polyclonal Antibody 
218771CB Anti-Caspase-10, C-Terminal (505-521), Human (Rabbit) 
218785CB Caspase-10, Human, Recombinant, E. coli 
PC379CB Anti-Caspase-11 (Ab-1) (Rabbit) 
PC379TCB Anti-Caspase-11 (Ab-1) (Rabbit) 
PC379TCB Caspase-11 (Ab-1) Polyclonal Antibody 
PC379CB Caspase-11 (Ab-1) Polyclonal Antibody 
PC445CB Anti-Caspase-11 (Ab-2) (Rabbit) 
PC445TCB Anti-Caspase-11 (Ab-2) (Rabbit) 
PC445TCB Caspase-11 (Ab-2) Polyclonal Antibody 
PC445CB Caspase-11 (Ab-2) Polyclonal Antibody 
PC557TCB Anti-Caspase-12 (Ab-1) (Rabbit) 
PC557CB Anti-Caspase-12 (Ab-1) (Rabbit) 
PC557CB Caspase-12 (Ab-1) Polyclonal Antibody 
PC557TCB Caspase-12 (Ab-1) Polyclonal Antibody 
PC558CB Anti-Caspase-12 (Ab-2) (Rabbit) 
PC558TCB Anti-Caspase-12 (Ab-2) (Rabbit) 
PC558CB Caspase-12 (Ab-2) Polyclonal Antibody 
PC558TCB Caspase-12 (Ab-2) Polyclonal Antibody 
PC526CB Anti-Caspase-13 (Ab-1) (Rabbit) 
PC526CB Caspase-13 (Ab-1) Polyclonal Antibody 
219005CB Caspase-13 Inhibitor I 
219009CB Caspase-13 Inhibitor II 
219006CB Caspase-13 Substrate I, Colorimetric 
AM64CB Anti-Caspase-14 (Ab-1) (Mouse) 
AM64CB Caspase-14 (Ab-1) Monoclonal Antibody 
PC107TCB Anti-Caspase-2 (Ab-1) (Rabbit) 
PC107CB Anti-Caspase-2 (Ab-1) (Rabbit) 
PC107CB Caspase-2 (Ab-1) Polyclonal Antibody 
PC107TCB Caspase-2 (Ab-1) Polyclonal Antibody 
218792CB Caspase-2 Assay Kit, Colorimetric 
218793CB Caspase-2 Assay Kit, Fluorometric 
218744CB Caspase-2 Inhibitor I 
218814CB Caspase-2 Inhibitor II 
218740CB Caspase-2 Substrate I, Fluorogenic 
218741CB Caspase-2 Substrate II, Fluorogenic 
218815CB Caspase-2 Substrate III, Fluorogenic 
218820CB Caspase-2 Substrate IV, Colorimetric 
218818CB Caspase-2 Substrate V, Fluorogenic 
218813CB Caspase-2, Human, Recombinant, E. coli 
AM20TCB Anti-Caspase-3 (Ab-1) (Mouse) 
AM20CB Anti-Caspase-3 (Ab-1) (Mouse) 
AM20TCB Caspase-3 (Ab-1) Monoclonal Antibody 
AM20CB Caspase-3 (Ab-1) Monoclonal Antibody 
AM34CB Anti-Caspase-3 (Ab-2) (Mouse) 
AM34TCB Anti-Caspase-3 (Ab-2) (Mouse) 
AM34TCB Caspase-3 (Ab-2) Monoclonal Antibody 
AM34CB Caspase-3 (Ab-2) Monoclonal Antibody 
AM39TCB Anti-Caspase-3 (Ab-3) (Mouse) 
AM39CB Anti-Caspase-3 (Ab-3) (Mouse) 
AM39CB Caspase-3 (Ab-3) Monoclonal Antibody 
AM39TCB Caspase-3 (Ab-3) Monoclonal Antibody 
AM65CB Anti-Caspase-3 (Ab-4) (Mouse) 
AM65CB Caspase-3 (Ab-4) Monoclonal Antibody 
QIA70CB Caspase-3 Activity Assay, Fluorometric 
HTS02CB Caspase-3 Activity Assay, HTS 
235418CB Caspase-3 Assay Kit 
235419CB Caspase-3 Cellular Activity Assay Kit 
235420CB Caspase-3 Inhibitor I 
235422CB Caspase-3 Inhibitor I, Biotin Conjugate 
235423CB Caspase-3 Inhibitor I, Cell-Permeable 
235427CB Caspase-3 Inhibitor I, Cell-Permeable, in Solution 
264155CB Caspase-3 Inhibitor II 
218747CB Caspase-3 Inhibitor II, Biotin Conjugate 
218750CB Caspase-3 Inhibitor III 
235421CB Caspase-3 Inhibitor IV 
219002CB Caspase-3 Inhibitor V 
235430CB Caspase-3 Intracellular Activity Assay Kit I (PhiPhiLux™ G1D2) 
235432CB Caspase-3 Intracellular Activity Assay Kit II (PhiPhiLux™ G2D2) 
235412CB Caspase-3 Polyclonal Antibody 
218787CB Caspase-3 Processing Inhibitor 
235400CB Caspase-3 Substrate I, Colorimetric 
235425CB Caspase-3 Substrate II, Fluorogenic 
235426CB Caspase-3 Substrate III, Fluorogenic 
264150CB Caspase-3 Substrate IV, Fluorogenic 
218751CB Caspase-3 Substrate V, Fluorogenic 
218752CB Caspase-3 Substrate VI, Fluorogenic 
264151CB Caspase-3 Substrate VII, Fluorogenic 
218823CB Caspase-3 Substrate VIII, Water-Soluble, Colorimetric 
WBB27CB Biotinylated Caspase-3 Western Blotting System 
235412CB Anti-Caspase-3, Human (Rabbit) 
235417CB Caspase-3, Human, Recombinant, E. coli 
218826CB Caspase-3-7 Inhibitor I 
PC109CB Anti-Caspase-4 (Ab-1) (Rabbit) 
PC109CB Caspase-4 (Ab-1) Polyclonal Antibody 
PC109TCB Caspase-4 (Ab-1) Polyclonal Antibody 
AM38CB Anti-Caspase-4 (Ab-2) (Mouse) 
AM38TCB Anti-Caspase-4 (Ab-2) (Mouse) 
AM38TCB Caspase-4 (Ab-2) Monoclonal Antibody 
AM38CB Caspase-4 (Ab-2) Monoclonal Antibody 
218755CB Caspase-4 Inhibitor I 
218766CB Caspase-4 Inhibitor I, Cell-Permeable 
218756CB Caspase-4 Substrate I, Fluorogenic 
218748CB Caspase-4 Substrate II, Fluorogenic 
218720CB Caspase-4, Human, Recombinant, E. coli 
218804CB Caspase-5 Assay Kit, Colorimetric 
218801CB Caspase-5 Assay Kit, Fluorometric 
218753CB Caspase-5 Inhibitor I 
218781CB Caspase-5 Polyclonal Antibody 
218736CB Caspase-5 Substrate I, Colorimetric 
218754CB Caspase-5 Substrate II, Fluorogenic 
218739CB Caspase-5 Substrate III, Fluorogenic 
218781CB Anti-Caspase-5, Human (Rabbit) 
218725CB Caspase-5, Human, Recombinant, E. coli 
PC365CB Anti-Caspase-6 (Ab-1) (Rabbit) 
PC365TCB Anti-Caspase-6 (Ab-1) (Rabbit) 
PC365TCB Caspase-6 (Ab-1) Polyclonal Antibody 
PC365CB Caspase-6 (Ab-1) Polyclonal Antibody 
PC416CB Anti-Caspase-6 (Ab-2) (Rabbit) 
PC416TCB Anti-Caspase-6 (Ab-2) (Rabbit) 
PC416TCB Caspase-6 (Ab-2) Polyclonal Antibody 
PC416CB Caspase-6 (Ab-2) Polyclonal Antibody 
218802CB Caspase-6 Assay Kit, Colorimetric 
218803CB Caspase-6 Assay Kit, Fluorometric 
218757CB Caspase-6 Inhibitor I 
218758CB Caspase-6 Inhibitor II 
218767CB Caspase-6 Inhibitor II, Cell-Permeable 
218774CB Caspase-6 Polyclonal Antibody 
218760CB Caspase-6 Substrate I, Fluorogenic 
218762CB Caspase-6 Substrate II, Colorimetric 
218763CB Caspase-6 Substrate III, Fluorogenic 
218789CB Caspase-6 Substrate VI, Fluorogenic 
219003CB Caspase-6 Substrate VII, Fluorogenic 
218774CB Anti-Caspase-6, Human (Rabbit) 
218799CB Caspase-6, Human, Recombinant, E. coli 
PC334CB Anti-Caspase-7 (Ab-1) (Rabbit) 
PC334TCB Anti-Caspase-7 (Ab-1) (Rabbit) 
PC334TCB Caspase-7 (Ab-1) Polyclonal Antibody 
PC334CB Caspase-7 (Ab-1) Polyclonal Antibody 
AM45TCB Anti-Caspase-7 (Ab-2) (Mouse) 
AM45CB Anti-Caspase-7 (Ab-2) (Mouse) 
AM45CB Caspase-7 (Ab-2) Monoclonal Antibody 
AM45TCB Caspase-7 (Ab-2) Monoclonal Antibody 
PC422CB Anti-Caspase-7 (Ab-3) (Rabbit) 
PC422CB Caspase-7 (Ab-3) Polyclonal Antibody 
218768CB Caspase-7 Substrate I, Fluorogenic 
218800CB Caspase-7, Human, Recombinant, E. coli 
PC335CB Anti-Caspase-8 (Ab-1) (Rabbit) 
PC335TCB Anti-Caspase-8 (Ab-1) (Rabbit) 
PC335TCB Caspase-8 (Ab-1) Polyclonal Antibody 
PC335CB Caspase-8 (Ab-1) Polyclonal Antibody 
PC349TCB Anti-Caspase-8 (Ab-2) (Rabbit) 
PC349CB Anti-Caspase-8 (Ab-2) (Rabbit) 
PC349TCB Caspase-8 (Ab-2) Polyclonal Antibody 
PC349CB Caspase-8 (Ab-2) Polyclonal Antibody 
AM46CB Anti-Caspase-8 (Ab-3) (Mouse) 
AM46TCB Caspase-8 (Ab-3) Monoclonal Antibody 
AM46CB Caspase-8 (Ab-3) Monoclonal Antibody 
QIA71CB Caspase-8 Activity Assay, Fluorometric 
HTS03CB Caspase-8 Activity Assay, HTS 
218770CB Caspase-8 Assay Kit 
368055CB Caspase-8 Inhibitor I 
218773CB Caspase-8 Inhibitor I, Cell-Permeable 
218759CB Caspase-8 Inhibitor II 
368056CB Caspase-8 inhibitor III 
218777CB Caspase-8 Polyclonal Antibody 
368057CB Caspase-8 Substrate I 
368059CB Caspase-8 Substrate II 
218769CB Caspase-8, Human, Recombinant, E. coli 
PC336CB Anti-Caspase-9 (Ab-1) (Rabbit) 
PC336TCB Anti-Caspase-9 (Ab-1) (Rabbit) 
PC336CB Caspase-9 (Ab-1) Polyclonal Antibody 
PC336TCB Caspase-9 (Ab-1) Polyclonal Antibody 
AM47CB Anti-Caspase-9 (Ab-2) (Mouse) 
AM47TCB Anti-Caspase-9 (Ab-2) (Mouse) 
AM47TCB Caspase-9 (Ab-2) Monoclonal Antibody 
AM47CB Caspase-9 (Ab-2) Monoclonal Antibody 
QIA72CB Caspase-9 Activity Assay, Fluorometric 
HTS04CB Caspase-9 Activity Assay, HTS 
218824CB Caspase-9 Assay Kit, Colorimetric 
218761CB Caspase-9 Inhibitor I 
218776CB Caspase-9 Inhibitor II, Cell-Permeable 
218728CB Caspase-9 Inhibitor III 
218794CB Caspase-9 Polyclonal Antibody 
PC475CB Anti-Caspase-9 S (Ab-1) (Rabbit) 
PC475CB Caspase-9 S (Ab-1) Polyclonal Antibody 
218765CB Caspase-9 Substrate I, Fluorogenic 
218805CB Caspase-9 Substrate II, Colorimetric 
218794CB Anti-Caspase-9, Human (Rabbit) 
218807CB Caspase-9, Human, Recombinant, E. coli 
343002CB Anti-Casper 
218775CB Castanospermine, Castanospermum australe 
01-62-0001CB Castro's Reagent 
216200CB CAT 
69235CB Cat Genomic DNA 
219263CB Catalase Assay Kit 
219010CB Catalase Polyclonal Antibody 
219261CB Catalase, Aspergillus niger 
219001CB Catalase, Bovine Liver 
219010CB Anti-Catalase, Human Erythrocyte (Rabbit) 
219008CB Catalase, Human Erythrocytes 
492006CB 5'-CATCTCCGCCGGTGCCGCCG-3' 
IM27LCB Cathepsin B (Ab-1) Monoclonal Antibody 
IM28LCB Anti-Cathepsin B (Ab-2) (Mouse) 
IM28LCB Cathepsin B (Ab-2) Monoclonal Antibody 
PC41CB Anti-Cathepsin B (Ab-3) (Rabbit) 
PC41CB Cathepsin B (Ab-3) Polyclonal Antibody 
219385CB Cathepsin B Inhibitor II 
205530CB Cathepsin B Inhibitor III 
205531CB Cathepsin B Inhibitor IV 
219408CB Cathepsin B Polyclonal Antibody 
219405CB Cathepsin B Substrate I, Colorimetric 
219391CB Cathepsin B Substrate II 
219392CB Cathepsin B Substrate III, Fluorogenic 
03-32-1570CB Cathepsin B Substrate IV, Fluorogenic 
03-32-1570CB Cathepsin B Substrate IV, Fluorogenic 
219366CB Cathepsin B, Bovine Spleen 
219364CB Cathepsin B, Human Liver 
219362CB Cathepsin B, Human Liver 
IM03CB Anti-Cathepsin D (Ab-1) (Mouse) 
IM03CB Cathepsin D (Ab-1) Monoclonal Antibody 
IM16CB Anti-Cathepsin D (Ab-2) (Rabbit) 
IM16CB Cathepsin D (Ab-2) Polyclonal Antibody 
PP42CB Pro-Cathepsin D Peptide 
219361CB Cathepsin D Polyclonal Antibody 
219399CB Cathepsin D Substrate I 
219398CB Cathepsin D, Bovine Kidney 
219396CB Cathepsin D, Bovine Spleen 
219401CB Cathepsin D, Human Liver 
219361CB Anti-Cathepsin D, Human Liver (Rabbit) 
219394CB Cathepsin D, Human Spleen 
QIA29CB Cathepsin D, Rapid Format ELISA 
219358CB Cathepsin G Polyclonal Antibody 
219407CB Cathepsin G Substrate I, Colorimetric 
219410CB Cathepsin G Substrate II, Colorimetric 
03-32-1527CB Cathepsin G Substrate III, Fluorogenic 
219438CB Cathepsin G Substrate III, Water-Soluble, Colorimetric 
219373CB Cathepsin G, Human Neutrophil 
219358CB Anti-Cathepsin G, Human Neutrophil (Rabbit) 
219414CB Cathepsin H Substrate II, Fluorogenic 
219416CB Cathepsin H, Bovine Kidney 
219404CB Cathepsin H, Human Liver 
219415CB Cathepsin Inhibitor I 
219417CB Cathepsin Inhibitor II 
219419CB Cathepsin Inhibitor III 
IM55LCB Anti-Cathepsin K (Ab-1) (Mouse) 
IM55LCB Cathepsin K (Ab-1) Monoclonal Antibody 
219386CB Cathepsin K Polyclonal Antibody 
219421CB Cathepsin L Inhibitor I 
219426CB Cathepsin L Inhibitor II 
219427CB Cathepsin L Inhibitor III 
219433CB Cathepsin L Inhibitor IV 
219435CB Cathepsin L Inhibitor V 
219387CB Cathepsin L Polyclonal Antibody 
219418CB Cathepsin L, Bovine Kidney 
219402CB Cathepsin L, Human Liver 
219412CB Cathepsin L, Paramecium tetraurelia 
219393CB Cathepsin S Inhibitor 
219389CB Cathepsin S Polyclonal Antibody 
219389CB Anti-Cathepsin S, Bovine (Rabbit) 
219388CB Cathepsin S, Bovine Spleen 
219420CB Cathepsin-Subtilisin Inhibitor 
219383CB Caveolin-2 Polyclonal Antibody 
219383CB Anti-Caveolin-2, Human and Mouse (Rabbit) 
219468CB CB-Protein Assay™ Kit 
216401CB Anti-CB1 Receptor 
216400CB CB1 Receptor Polyclonal Antibody 
70157CB CBDcenA•Tag™ Antibody 
70141CB CBDcenA•Tag™ Primer 
70142CB CBDcex LEAD primer 
70158CB CBDcex•Tag™ Antibody 
70119CB CBDclos•Tag™ Antibody 
70118CB CBDclos•Tag™ primer 
234599CB CBE 
PC288CB Anti-CBFb (Ab-1) (Rabbit) 
PC288CB CBFb (Ab-1) Polyclonal Antibody 
235200CB CBG 
70120CB CBIND™ 100 Resin 
70121CB CBIND™ 200 Resin 
70124CB CBIND™ 300 Cartridges 
70132CB CBIND™ 900 Cartridges 
70122CB CBIND™ Buffer Kit 
70144CB CBIND™ ReadyRun™ Columns 
215911CB CCCP 
217370CB (2S,3S,4S)-CCG 
217370CB L-CCG-I 
C-085CB CCK-4 
C-081CB CCK-8 
PC206LCB CCK-8 
PC206LCB Anti-CCK-8 
227020CB Anti-CCR1 
PC559CB Anti-CCR5 (Ab-1) (Rabbit) 
PC559TCB Anti-CCR5 (Ab-1) (Rabbit) 
PC559CB CCR5 (Ab-1) Polyclonal Antibody 
PC559TCB CCR5 (Ab-1) Polyclonal Antibody 
PC430CB Anti-CCR8 (Ab-1) (Rabbit) 
PC430CB CCR8 (Ab-1) Polyclonal Antibody 
227025CB CCVJ 
227026CB CCVJ-NHS Ester 
324762CB CD10 
217686CB CD104 Monoclonal Antibody 
217687CB CD104 Monoclonal Antibody Fluorescein Conjugate 
217686CB Anti-CD104, Human (Mouse) 
217687CB Anti-CD104, Human (Mouse) Fluorescein Conjugate 
GR19LCB Anti-CD105 
OP173CB Anti-CD105 (Ab-1) (Mouse) 
OP173CB CD105 (Ab-1) Monoclonal Antibody 
CP55CB Anti-CD106 
OP174CB Anti-CD106 (Ab-1) (Mouse) 
OP174CB CD106 (Ab-1) Monoclonal Antibody 
217635CB CD106 Monoclonal Antibody 
217636CB CD106 Monoclonal Antibody Biotin Conjugate 
217637CB CD106 Monoclonal Antibody Fluorescein Conjugate 
217635CB Anti-CD106, Human (Mouse) 
217636CB Anti-CD106, Human (Mouse) Biotin Conjugate 
217637CB Anti-CD106, Human (Mouse) Fluorescein Conjugate 
218150CB CD117 Monoclonal Antibody 
218150CB Anti-CD117, Human (Mouse) 
407295CB Anti-CD118 
217640CB Anti-CD11a, Human (Mouse) 
217641CB Anti-CD11a, Human (Mouse) Fluorescein Conjugate 
217642CB CD11b Monoclonal Antibody 
217643CB Anti-CD11b, Human (Mouse) Fluorescein Conjugate 
217645CB CD11c Monoclonal Antibody Fluorescein Conjugate 
217644CB Anti-CD11c, Human (Mouse) 
217645CB Anti-CD11c, Human (Mouse) Fluorescein Conjugate 
BA22CB Anti-CD13 
100080CB Anti-CD137 
OP162CB CD15 (Ab-1) Monoclonal Antibody 
427335CB CD15 antigen 
217646CB CD15 Monoclonal Antibody 
217647CB CD15 Monoclonal Antibody Fluorescein Conjugate 
217646CB Anti-CD15, Human (Mouse) 
217647CB Anti-CD15, Human (Mouse) Fluorescein Conjugate 
218120CB CD152 Monoclonal Antibody 
218120CB Anti-CD152, Human (Mouse) 
217690CB CD152-Fc Fusion Protein, Human, Recombinant, BHK Cell Line 
217650CB CD16 Monoclonal Antibody 
217652CB CD16 Monoclonal Antibody Fluorescein Conjugate 
217654CB CD16 Monoclonal Antibody R-Phycoerythrin Conjugate 
217650CB Anti-CD16, Human (Mouse) 
217652CB Anti-CD16, Human (Mouse) Fluorescein Conjugate 
217654CB Anti-CD16, Human (Mouse) R-Phycoerythrin Conjugate 
218130CB CD162 Monoclonal Antibody 
218131CB CD162 Monoclonal Antibody R-Phycoerythrin Conjugate 
218130CB Anti-CD162, Human (Mouse) 
218131CB Anti-CD162, Human (Mouse) R-Phycoerythrin Conjugate 
217688CB CD165 Monoclonal Antibody 
217689CB CD165 Monoclonal Antibody Fluorescein Conjugate 
217688CB Anti-CD165, Human (Mouse) 
217689CB Anti-CD165, Human (Mouse) Fluorescein Conjugate 
217664CB CD18 Monoclonal Antibody R-Phycoerythrin Conjugate 
217660CB Anti-CD18, Human (Mouse) 
217664CB Anti-CD18, Human (Mouse) R-Phycoerythrin Conjugate 
217665CB CD19 Monoclonal Antibody 
217667CB CD19 Monoclonal Antibody Fluorescein Conjugate 
217665CB Anti-CD19, Human (Mouse) 
217667CB Anti-CD19, Human (Mouse) Fluorescein Conjugate 
217670CB CD20 Monoclonal Antibody 
217672CB CD20 Monoclonal Antibody Fluorescein Conjugate 
217670CB Anti-CD20, Human (Mouse) 
217672CB Anti-CD20, Human (Mouse) Fluorescein Conjugate 
OP175CB CD231 (Ab-1) Monoclonal Antibody 
OP163CB CD24 (Ab-1) Monoclonal Antibody 
217584CB CD27 (65-80) Polyclonal Antibody 
217584CB Anti-CD27 (65-80), Human (Rabbit) 
217669CB CD28 Monoclonal Antibody 
217669CB Anti-CD28, Human (Mouse) 
217648CB CD29 Monoclonal Antibody 
217649CB CD29 Monoclonal Antibody Fluorescein Conjugate 
217648CB Anti-CD29, Human (Mouse) 
PC630CB CD3 (Ab-1) Polyclonal Antibody 
217570CB CD3 Monoclonal Antibody 
217571CB CD3 Monoclonal Antibody Biotin Conjugate 
217572CB CD3 Monoclonal Antibody Fluorescein Conjugate 
217573CB CD3 Monoclonal Antibody R-Phycoerythrin Conjugate 
217570CB Anti-CD3, Human (Mouse) 
217571CB Anti-CD3, Human (Mouse) Biotin Conjugate 
217572CB Anti-CD3, Human (Mouse) Fluorescein Conjugate 
217573CB Anti-CD3, Human (Mouse) R-Phycoerythrin Conjugate 
OP164CB CD34 (Ab-1) Monoclonal Antibody 
217575CB CD4 Monoclonal Antibody 
217576CB CD4 Monoclonal Antibody Biotin Conjugate 
217577CB CD4 Monoclonal Antibody Fluorescein Conjugate 
217578CB CD4 Monoclonal Antibody R-Phycoerythrin Conjugate 
217575CB Anti-CD4, Human (Mouse) 
217576CB Anti-CD4, Human (Mouse) Biotin Conjugate 
217577CB Anti-CD4, Human (Mouse) Fluorescein Conjugate 
217578CB Anti-CD4, Human (Mouse) R-Phycoerythrin Conjugate 
PC370CB Anti-cd40 
217586CB CD40 (258-277) Polyclonal Antibody 
217586CB Anti-CD40 (258-277), Human (Rabbit) 
PF091CB CD40 Ligand Kit 
217590CB CD40 Monoclonal Antibody 
217591CB CD40 Monoclonal Antibody Biotin Conjugate 
217592CB CD40 Monoclonal Antibody Fluorescein Conjugate 
217593CB CD40 Monoclonal Antibody R-Phycoerythrin Conjugate 
217590CB Anti-CD40, Human (Mouse) 
217591CB Anti-CD40, Human (Mouse) Biotin Conjugate 
217592CB Anti-CD40, Human (Mouse) Fluorescein Conjugate 
217593CB Anti-CD40, Human (Mouse) R-Phycoerythrin Conjugate 
217588CB CD40-Fc Fusion Protein, Human, Recombinant, CHO Cell Line 
PF090CB CD40-Fc, Human, Recombinant 
217595CB CD40L Monoclonal Antibody 
217596CB CD40L Monoclonal Antibody Biotin Conjugate 
217597CB CD40L Monoclonal Antibody Fluorescein Conjugate 
217598CB CD40L Monoclonal Antibody R-Phycoerythrin Conjugate 
217595CB Anti-CD40L, Human (Mouse) 
217596CB Anti-CD40L, Human (Mouse) Biotin Conjugate 
217597CB Anti-CD40L, Human (Mouse) Fluorescein Conjugate 
217598CB Anti-CD40L, Human (Mouse) R-Phycoerythrin Conjugate 
OP165CB CD42b (Ab-1) Monoclonal Antibody 
217594CB CD44 Monoclonal Antibody 
217604CB Anti-CD44 Variant Isoform with Exon-10 (v6) 
217609CB Anti-CD44 Variant Isoform with Exon-11 (v7) 
217599CB Anti-CD44 Variant Isoform with Exon-7 (v3) 
217594CB Anti-CD44, Human (Rat) 
217685CB CD44v10 Polyclonal Antibody 
217685CB Anti-CD44v10, Human (Rabbit) 
217599CB CD44v3 Polyclonal Antibody 
217599CB Anti-CD44v3, Human (Rabbit) 
217604CB CD44v6 Polyclonal Antibody 
217604CB Anti-CD44v6, Human (Rabbit) 
217609CB CD44v7 Polyclonal Antibody 
217609CB Anti-CD44v7, Human (Rabbit) 
OP166CB CD45 (Ab-1) Monoclonal Antibody 
217614CB CD45 PTPase 
219454CB CD45 Tyrosine Phosphatase Assay Kit, Colorimetric 
OP167CB CD47 (Ab-1) Monoclonal Antibody 
217656CB CD49b Monoclonal Antibody Fluorescein Conjugate 
217655CB Anti-CD49b, Human (Mouse) 
217600CB CD49d Monoclonal Antibody 
217601CB CD49d Monoclonal Antibody Biotin Conjugate 
217602CB CD49d Monoclonal Antibody Fluorescein Conjugate 
217603CB CD49d Monoclonal Antibody R-Phycoerythrin Conjugate 
217600CB Anti-CD49d, Human (Mouse) 
217601CB Anti-CD49d, Human (Mouse) Biotin Conjugate 
217657CB CD49f Monoclonal Antibody 
217658CB CD49f Monoclonal Antibody Fluorescein Conjugate 
217657CB Anti-CD49f, Human (Mouse) 
217658CB Anti-CD49f, Human (Mouse) Fluorescein Conjugate 
217674CB CD50 Monoclonal Antibody Fluorescein Conjugate 
217673CB Anti-CD50, Human (Mouse) 
217675CB CD51 Monoclonal Antibody 
217676CB CD51 Monoclonal Antibody Fluorescein Conjugate 
217675CB Anti-CD51, Human (Mouse) 
217676CB Anti-CD51, Human (Mouse) Fluorescein Conjugate 
CP53CB Anti-CD54 
217605CB CD54 Monoclonal Antibody 
217677CB CD54 Monoclonal Antibody 
217606CB CD54 Monoclonal Antibody Biotin Conjugate 
217607CB CD54 Monoclonal Antibody Fluorescein Conjugate 
217608CB CD54 Monoclonal Antibody R-Phycoerythrin Conjugate 
217605CB Anti-CD54, Human (Mouse) 
217677CB Anti-CD54, Human (Mouse) 
217606CB Anti-CD54, Human (Mouse) Biotin Conjugate 
217607CB Anti-CD54, Human (Mouse) Fluorescein Conjugate 
217678CB Anti-CD54, Human (Mouse) Fluorescein Conjugate 
OP168CB CD55 (Ab-1) Monoclonal Antibody 
217680CB CD55 Monoclonal Antibody Fluorescein Conjugate 
217679CB Anti-CD55, Human (Mouse) 
217680CB Anti-CD55, Human (Mouse) Fluorescein Conjugate 
OP169CB Anti-CD56 (Ab-1) (Mouse) 
OP169CB CD56 (Ab-1) Monoclonal Antibody 
217671CB CD56 Monoclonal Antibody 
OP170CB CD57 (Ab-1) Monoclonal Antibody 
217610CB CD60 Monoclonal Antibody 
217611CB CD60 Monoclonal Antibody Biotin Conjugate 
217612CB CD60 Monoclonal Antibody Fluorescein Conjugate 
217610CB Anti-CD60, Human (Mouse) 
217611CB Anti-CD60, Human (Mouse) Biotin Conjugate 
217612CB Anti-CD60, Human (Mouse) Fluorescein Conjugate 
561300CB CD62E 
217681CB CD62E Monoclonal Antibody 
217615CB CD62E Monoclonal Antibody 
217617CB CD62E Monoclonal Antibody Fluorescein Conjugate 
217682CB CD62E Monoclonal Antibody Fluorescein Conjugate 
217615CB Anti-CD62E, Human (Mouse ) 
217682CB Anti-CD62E, Human (Mouse ) Fluorescein Conjugate 
217681CB Anti-CD62E, Human (Mouse) 
561303CB CD62L 
217683CB CD62L Monoclonal Antibody 
217684CB CD62L Monoclonal Antibody Fluorescein Conjugate 
217683CB Anti-CD62L, Human (Mouse) 
217684CB Anti-CD62L, Human (Mouse) Fluorescein Conjugate 
561306CB CD62P 
OP171CB CD63 (Ab-1) Monoclonal Antibody 
217620CB CD64 Monoclonal Antibody 
217622CB CD64 Monoclonal Antibody Fluorescein Conjugate 
217623CB CD64 Monoclonal Antibody R-Phycoerythrin Conjugate 
217620CB Anti-CD64, Human (Mouse) 
217622CB Anti-CD64, Human (Mouse) Fluorescein Conjugate 
217623CB Anti-CD64, Human (Mouse) R-Phycoerythrin Conjugate 
217850CB CD69 Monoclonal Antibody 
217852CB CD69 Monoclonal Antibody Fluorescein Conjugate 
217850CB Anti-CD69, Human (Mouse) 
217852CB Anti-CD69, Human (Mouse) Fluorescein Conjugate 
GR08LCB Anti-CD71 
GR09LCB Anti-CD71 
217580CB CD8 Monoclonal Antibody 
217581CB CD8 Monoclonal Antibody Biotin Conjugate 
217582CB CD8 Monoclonal Antibody Fluorescein Conjugate 
217580CB Anti-CD8, Human (Mouse) 
217581CB Anti-CD8, Human (Mouse) Biotin Conjugate 
217582CB Anti-CD8, Human (Mouse) Fluorescein Conjugate 
217625CB CD80 Monoclonal Antibody 
217626CB CD80 Monoclonal Antibody Biotin Conjugate 
217627CB CD80 Monoclonal Antibody Fluorescein Conjugate 
217625CB Anti-CD80, Human (Mouse) 
217627CB Anti-CD80, Human (Mouse) Fluorescein Conjugate 
217630CB CD86 Monoclonal Antibody 
217631CB CD86 Monoclonal Antibody Biotin Conjugate 
217632CB CD86 Monoclonal Antibody Fluorescein Conjugate 
217633CB CD86 Monoclonal Antibody R-Phycoerythrin Conjugate 
217630CB Anti-CD86, Human (Mouse) 
217631CB Anti-CD86, Human (Mouse) Biotin Conjugate 
217632CB Anti-CD86, Human (Mouse) Fluorescein Conjugate 
217633CB Anti-CD86, Human (Mouse) R-Phycoerythrin Conjugate 
CP28CB Anti-CD90 (Ab-1) (Mouse) 
217950CB CD94 Monoclonal Antibody 
217950CB Anti-CD94, Human (Mouse) 
PC69CB Anti-CD95 
PC480CB Anti-CD95 
AM01TCB CD95 
AM01CB CD95 
AM01LCB Anti-CD95 
AM29CB Anti-CD95L 
AM40CB CD95L 
PC78CB Anti-CD95L 
PF033CB CD95L 
QIA27CB CD95L 
PP61CB CD95L 
PC105CB Anti-CD95L 
217952CB CD95L Monoclonal Antibody Fluorescein Conjugate 
217952CB Anti-CD95L, Human (Mouse) Fluorescein Conjugate 
506100CB Anti-Cdc2 
PC25CB Anti-Cdc2-Cdk1 (Ab-1) (Rabbit) 
PC25CB Cdc2-Cdk1 (Ab-1) Polyclonal Antibody 
CC01CB Anti-Cdc2-Cdk1 (Ab-2) (Mouse) 
CC01CB Cdc2-Cdk1 (Ab-2) Monoclonal Antibody 
CC16CB Anti-Cdc2-Cdk1 (Ab-3) (Mouse) 
CC16FCB Anti-Cdc2-Cdk1 (Ab-3) (Mouse) Fluorescein Conjugate 
CC16CB Cdc2-Cdk1 (Ab-3) Monoclonal Antibody 
CC16FCB Cdc2-Cdk1 (Ab-3) Monoclonal Antibody Fluorescein Conjugate 
PP33CB Cdc2-Cdk1 Peptide 
CC25CB Anti-Cdc25B (Ab-1) (Mouse) 
CC25CB Cdc25B (Ab-1) Monoclonal Antibody 
CC26CB Anti-Cdc25C (Ab-1) (Mouse) 
CC26TCB Anti-Cdc25C (Ab-1) (Mouse) 
CC26TCB Cdc25C (Ab-1) Monoclonal Antibody 
CC26CB Cdc25C (Ab-1) Monoclonal Antibody 
CC32CB Anti-Cdc25C (Ab-2) (Mouse) 
CC32CB Cdc25C (Ab-2) Monoclonal Antibody 
CC33CB Anti-Cdc25C (Ab-3) (Mouse) 
CC33CB Cdc25C (Ab-3) Monoclonal Antibody 
CC34CB Anti-Cdc25C (Ab-4) (Mouse) 
CC34CB Cdc25C (Ab-4) Monoclonal Antibody 
322400CB Anti-Cdc25C associated protein kinase 
CC25CB cdc25hu2 
219429CB Cdc37 Polyclonal Antibody 
219430CB Cdc42, His•Tag®, Rat Brain, Recombinant, E. coli 
506277CB Anti-Cdc42-Rac Activated Kinase 3 
219436CB Cdc42Hs Polyclonal Antibody 
219432CB Cdc42Hs, GST•Tag™ Human, Recombinant, E. coli 
219434CB Cdc42Hs, His•Tag®, Human, Recombinant, E. coli 
CC27CB Anti-Cdc6 (Ab-1) (Mouse) 
CC27CB Cdc6 (Ab-1) Monoclonal Antibody 
CC28CB Anti-Cdc6 (Ab-2) (Mouse) 
CC28TCB Anti-Cdc6 (Ab-2) (Mouse) 
CC28TCB Cdc6 (Ab-2) Monoclonal Antibody 
CC28CB Cdc6 (Ab-2) Monoclonal Antibody 
CC30CB Anti-Cdc6 (Ab-3) (Mouse) 
CC30TCB Anti-Cdc6 (Ab-3) (Mouse) 
CC30TCB Cdc6 (Ab-3) Monoclonal Antibody 
CC30CB Cdc6 (Ab-3) Monoclonal Antibody 
01-62-0002CB CDI 
CC01CB Anti-Cdk1 
PC25CB Anti-Cdk1 
217701CB Cdk1 (263-297) Blocking Peptide, Mouse 
217700CB Cdk1 (263-297) Polyclonal Antibody 
217700CB Anti-Cdk1 (263-297), Mouse (Rabbit) 
506100CB Cdk1 Monoclonal Antibody 
217705CB Cdk1 Substrate II 
506100CB Anti-Cdk1, Human (Mouse) 
219440CB Cdk1, Phospho-Specific Polyclonal Antibody 
219440CB Anti-Cdk1, Phospho-Specific, Human (Rabbit) 
PC44CB Anti-Cdk2 (Ab-1) (Rabbit) 
PC44CB Cdk2 (Ab-1) Polyclonal Antibody 
219442CB Cdk2 Inhibitor I 
219445CB Cdk2 Inhibitor II 
219444CB Cdk2, C-Terminal (283-298) Blocking Peptide, Human 
219443CB Cdk2, C-Terminal (283-298) Polyclonal Antibody 
219443CB Anti-Cdk2, C-Terminal (283-298), Human (Rabbit) 
238801CB Cdk2-Cyclin Inhibitory Peptide I 
238802CB Cdk2-Cyclin Inhibitory Peptide II 
PC45CB Cdk4 (Ab-1) Polyclonal Antibody 
CC19LCB Anti-Cdk4 (Ab-2) (Mouse) 
CC19LCB Cdk4 (Ab-2) Monoclonal Antibody 
CC20LCB Anti-Cdk4 (Ab-3) (Mouse) 
CC20LCB Cdk4 (Ab-3) Monoclonal Antibody 
CC21LCB Anti-Cdk4 (Ab-4) (Mouse) 
CC21LCB Cdk4 (Ab-4) Monoclonal Antibody 
219447CB Cdk4, C-Terminal (277-297) Blocking Peptide, Human 
219446CB Cdk4, C-Terminal (277-297) Polyclonal Antibody 
219446CB Anti-Cdk4, C-Terminal (277-297), Human (Rabbit) 
CC09LCB Anti-Cdk5 (Ab-1) (Mouse) 
CC09LCB Cdk5 (Ab-1) Monoclonal Antibody 
CC10LCB Anti-Cdk5 (Ab-2) (Mouse) 
CC10LCB Cdk5 (Ab-2) Monoclonal Antibody 
PC46CB cdk5 (Ab-3) Polyclonal Antibody 
219451CB Cdk5 Substrate 
219450CB Cdk5, C-Terminal (268-283) Blocking Peptide, Human 
219449CB Cdk5, C-Terminal (268-283) Polyclonal Antibody 
219449CB Anti-Cdk5, C-Terminal (268-283), Human (Rabbit) 
CC22LCB Anti-Cdk6 (Ab-1) (Mouse) 
CC22LCB Cdk6 (Ab-1) Monoclonal Antibody 
CC23LCB Anti-Cdk6 (Ab-2) (Mouse) 
CC23LCB Cdk6 (Ab-2) Monoclonal Antibody 
219453CB Cdk6, C-Terminal (306-326) Blocking Peptide, Human 
219452CB Cdk6, C-Terminal (306-326) Polyclonal Antibody 
219452CB Anti-Cdk6, C-Terminal (306-326), Human (Rabbit) 
PC476CB Cdk8 (Ab-1) Polyclonal Antibody 
217706CB Cdk8, N-Terminal (1-15) Blocking Peptide, Human 
217704CB Cdk8, N-Terminal (1-15) Polyclonal Antibody 
217704CB Anti-Cdk8, N-Terminal (1-15), Human (Rabbit) 
69086CB CDP-Star® AP Substrate 
228180CB CE 
219369CB CEA 
219368CB CEA 
C-S-077CB CEA (605-613) 
219380CB Cefotaxime, Sodium Salt 
ASK03CB Cell Cycle Antibody Sampler Kit 
QIA20CB Cell Death Detection (Nuclear Matrix Protein) ELISA 
PC431CB Anti-Cell Death-Inducing DFFA-like Effector A 
PC432CB Anti-Cell Death-Inducing DFFA-like Effector A 
217700CB Anti-Cell Division Control Protein 2 
235423CB Cell-permeable, DEVD-CHO 
219458CB D(+)Cellobiose 
219464CB D(+)Cellotriose 
341633CB Cellular Fibronectin 
21947CB Cellulase, Aspergillus niger 
219473CB Cellulose, Rhodamine B 
219466CB CELLULYSIN® Cellulase, Trichoderma viride 
220100CB Anti-CENP-F 
219475CB CENTA™ b-Lactamase Substrate 
220100CB Centromere Protein-F Polyclonal Antibody 
220100CB Anti-Centromere Protein-F, Human (Rabbit) 
345736CB Cer-Glc-Gal(NeuAc)-GalNAc-Gal-NeuAc ·2NH4 
567725CB Ceramide 
567726CB Ceramide 
506420CB C16 Ceramide 
573750CB Ceramide Galactoside Sulfate 
219484CB Ceramide Glycanase, Macrobdella decora 
219487CB Ceramide Trihexoside, Porcine 
110145CB C2 Ceramide 
376650CB C6 Ceramide 
219540CB C8 Ceramide 
219537CB C2 Dihydroceramide 
219535CB C8 Ceramide-1-phosphate 
567725CB Cerebroside 
567726CB Cerebroside 
219490CB Cerebrosides, Bovine 
219510CB CeReS-18, Bovine Brain 
219515CB CeReS-18, Bovine Brain, Protease-Free 
219557CB Cerulenin, Cephalosporium caerulens 
239799CB Ceruloplasmin, Human Plasma 
219650CB Cesium Chloride, Molecular Biology Grade 
219649CB Cesium Chloride, ULTROL® Grade 
219652CB Cesium Sulfate, ULTROL® Grade 
219655CB CETP Activity Assay Kit, Fluorometric 
219374CB Cetrimide 
219374CB Cetyltrimethylammonium Bromide, Molecular Biology Grade 
370659CB Anti-cGMP (Rabbit) 
539727CB Anti-cGMP-dependent Protein Kinase 
370659CB cGMP Polyclonal Antibody 
370656CB cGMP, Na 
370669CB cGMP-AM 
524715CB cGMP-binding cGMP-specific PDE 
524583CB Anti-cGMP-Binding, cGMP-Specific PDE 
539729CB Anti-cGMP-dependent Protein Kinase 
370661CB Anti-cGMP-dependent Protein Kinase 
5-23-2404CB aCGRP 
5-23-2405CB bCGRP 
C-195CB CGRP I (8-37) (human) 
C-190CB CGRP I (human) 
5-23-2404CB CGRP-I 
5-23-2407CB CGRP-I 8-37 
5-23-2405CB CGRP-II 
C-O-003CB CH3CO2CH2CH2N+(CH3)3Cl- 
C-O-003-1CB CH3CO2CH2CH2N+(CH3)3Cl- 
116830CB CHA 
203783CB CHA-X-Gluc 
220197CB Chaetomellic Acid A, Disodium Salt 
200965CB CHAP, Big 
220198CB Chaperonin 10 (91-101) Polyclonal Antibody 
220198CB Anti-Chaperonin 10 (91-101), Human (Rabbit) 
220201CB CHAPS 
220202CB CHAPSO 
220332CB Charybdotoxin, Leiurus quinquestriatus hebraeus 
220334CB Charybdotoxin, Recombinant, E. coli 
NB05LCB Anti-ChAT 
220285CB Chelerythrine Chloride 
220300CB Chemiluminescent Labeling Kit 
2204CB Chenodeoxycholic Acid, Free Acid 
220411CB Chenodeoxycholic Acid, Sodium Salt 
239779CB CHES, ULTROL® Grade 
345877CB Chicken g-Globulin, Serum 
69233CB Chicken Genomic DNA 
401930CB Chicken IgG, H & L Chain Specific Polyclonal Antibody 
401520CB Anti-Chicken IgG, H & L Chain Specific (Sheep) Peroxidase Conjugate 
178611CB Anti-CHIP28 
220340CB Chitin, Azure, Crab Shell 
220472CB Chitobiose, N,N'-Diacetyl- 
220476CB Chitohexaose, N,N',N'',N''',N'''',N'''''-Hexaacetyl- 
220475CB Chitopentaose, N,N',N'',N''',N''''-Pentaacetyl- 
346299CB Chitosamine 
220477CB Chitosan N-acetylglucosaminohydrolase 
220347CB Chitosan Polysaccharide Mixture, Crab Shell 
220345CB Chitosan, Azure, Crab Shell 
220477CB Chitosanase, Streptomyces sp. N174 
220474CB Chitotetraose, N,N',N'',N'''-Tetraacetyl- 
220473CB Chitotriose, N,N',N''-Triacetyl- 
PC423CB Anti-Chk1 (Ab-1) (Sheep) 
PC423CB Chk1 (Ab-1) Polyclonal Antibody 
PC483CB Anti-Chk2 
CC44CB Chk2 (Ab-2) Monoclonal Antibody 
220540CB Chk2 Polyclonal Antibody 
220540CB Anti-Chk2, Human (Sheep) 
PC483CB Anti-Chk2-hCds1 (Ab-1) (Rabbit) 
PC483TCB Anti-Chk2-hCds1 (Ab-1) (Rabbit) 
PC483TCB Chk2-hCds1 (Ab-1) Polyclonal Antibody 
PC483CB Chk2-hCds1 (Ab-1) Polyclonal Antibody 
220551CB Chloramphenicol 
220557CB Chlorhexidine, Dihydrochloride 
220562CB Anti-Chloride Channel 2 
220563CB Anti-Chloride Channel 3 
647950CB 5-Chloro-2-(2,4-dichlorophenoxy)phenol 
205500CB 2-Chloro-2'-arabinofluoro-2'-deoxyadenosine 
233165CB 5-Chloro-7-iodo-8-hydroxyquinoline 
475889CB 3-[1-(p-Chlorobenzyl)-5-(isopropyl)-3-t-butylthioindol-2-yl]-2,2-dimethylpropanoic Acid, Na 
233180CB N-(4-Chlorobenzyl)-S-[3-(4(5)-imidazolyl)propyl]isothiourea, HBr 
239785CB N,N-bis(2-Chloroethyl)tetrahydro-2H-1,3,2-oxazaphosphorin-2-amine-2-oxide Monohydrate 
01-64-0104CB Chloromethylpolystyrene-divinylbenzene (100-200 mesh) 
01-64-0008CB Chloromethylpolystyrene-divinylbenzene (100-200 mesh) 
01-64-0070CB Chloromethylpolystyrene-divinylbenzene (100-200 mesh) 
01-64-0002CB Chloromethylpolystyrene-divinylbenzene (200-400 mesh) 
01-64-0007CB Chloromethylpolystyrene-divinylbenzene (200-400 mesh) 
01-64-0185CB Chloromethylpolystyrene-divinylbenzene (70-90 mesh) 
220588CB Chlorophenolred-b-D-galactopyranoside, Sodium Salt 
220557CB 1,6-bis[N'-(p-Chlorophenyl)-N5-biguanido]hexane, 2HCl 
565605CB 4-[5-(4-Chlorophenyl)-3-(trifluoromethyl)-1H-pyrazol-1-yl]benzenesulfonamide 
211280CB N-[2-(4-Chlorophenyl)ethyl]-1,3,4,5-tetrahydro-7,8-dihydroxy-2H-2-benzazepine-2-carbothioamide 
230750CB Chlorotoxin, Leiurus quinquestriatus 
681725CB [4-Chloro-6-(2,3-xylidino)-2-pyrimidinylthio]acetic Acid 
215921CB Chlorpromazine, Hydrochloride 
438101CB 5b-Cholan-24-oic acid-3a-ol 
679103CB Cholecalciferol 
C-081CB Cholecystokinin Octapeptide 
C-085CB Cholecystokinin Tetrapeptide 
PC206LCB Cholecystokinin-8 (Ab-1) Polyclonal Antibody 
227042CB Cholera Toxin, B Subunit, Recombinant 
227043CB Cholera Toxin, B Subunit, Saporin Conjugate 
227040CB Cholera Toxin, b-Subunit Polyclonal Antibody 
227040CB Anti-Cholera Toxin, b-Subunit, Vibrio cholerae (Goat) 
227037CB Cholera Toxin, A Subunit, Vibrio cholerae, Type Inaba 569B 
227041CB Cholera Toxin, B Subunit, Type Inaba 569B, Peroxidase Conjugate 
227039CB Cholera Toxin, B Subunit, Vibrio cholerae, Type Inaba 569B 
227035CB Cholera Toxin, Vibrio cholerae, Type Inaba 569B 
227036CB Cholera Toxin, Vibrio cholerae, Type Inaba 569B, Azide Free 
228120CB Cholesterol Concentrate, Bovine 
228125CB Cholesterol Concentrate, Human, High Density Lipoprotein 
228180CB Cholesterol Esterase, Microbial 
228230CB Cholesterol Oxidase, Nocardia sp. 
228111CB Cholesterol, Highly Purified 
219655CB Cholesteryl Ester Transfer Protein Activity Assay Kit 
229101CB Cholic Acid, Sodium Salt 
229102CB Cholic Acid, Sodium Salt, ULTROL® Grade 
NB05LCB Choline Acetyl Transferase (Ab-1) Monoclonal Antibody 
230687CB Chondroitin Sulfate A, Bovine Trachea 
2307CB Chondroitin Sulfate C, Sodium Salt, Shark Cartilage 
230688CB Chondroitin Sulfate D Monoclonal Antibody 
230688CB Anti-Chondroitin Sulfate D, Chicken (Mouse) 
230689CB Chondroitin Sulfate D, Sodium Salt, Shark Cartilage 
230690CB Chondroitin Sulfate E, Sodium Salt, Squid Cartilage 
230691CB Chondroitin Unsaturated Disaccharide DDi-0S, Sodium Salt 
230692CB Chondroitin Unsaturated Disaccharide DDi-4S, Disodium Salt 
230693CB Chondroitin Unsaturated Disaccharide DDi-6S, Disodium Salt 
230696CB Chondroitin Unsaturated Disaccharide DDi-diSB, Trisodium Salt 
230697CB Chondroitin Unsaturated Disaccharide DDi-diSD, Trisodium Salt 
230698CB Chondroitin Unsaturated Disaccharide DDi-triS, Tetrasodium Salt 
230694CB Chondroitin Unsaturated Disaccharide DDi-UA2S, Disodium Salt 
230687CB Chondroitin-4-sulfate 
2307CB Chondroitin-6-sulfate 
230686CB Anti-Chondroitin-6-sulfate, Rat (Mouse) 
230681CB Chondroitinase ABC, Proteus vulgaris 
230685CB Chondroitinase ABC, Recombinant 
230682CB Chondroitinase AC I, Flavobacterium heparinum 
230683CB Chondroitinase AC II, Arthrobacter aurenscens 
230684CB Chondroitinase B, Flavobacterium heparinum 
230740CB Chorionic Gonadotropin Monoclonal Antibody 
969126CB Chorionic Gonadotropin, b-Subunit, Human Urine, Iodination Grade 
869031CB Chorionic Gonadotropin, Human Urine, Iodination Grade 
230734CB Chorionic Gonadotropin, Human Urine, Standard Grade 
233279CB Christmas Factor 
CC36CB Anti-Chromatin Assembly Factor-1 
CC31TCB Chromatin Assembly Factor-1 
CC31CB Anti-Chromatin Assembly Factor-1 
69673CB Chromatography Columns 
230752CB Chromomycin A3 
238540CB ChromoSave™ Reagent 
263301CB Chrondroitin Sulfate B 
230695CB Chrondroitin Unsaturated Disaccharide DDi-diSE, Trisodium Salt 
APS01CB Chronic Myelogenous Leukemia 
220332CB ChTx 
220557CB CHX 
230780CB Chymase, Human Skin 
230790CB Chymostatin 
230906CB Chymotrypsin Inhibitor I, Potato 
230912CB Chymotrypsin Substrate I, Colorimetric 
230914CB Chymotrypsin Substrate II, Fluorogenic 
230916CB Chymotrypsin Substrate III, Fluorogenic 
230834CB Chymotrypsin, Bovine Pancreas, High Purity, Endotoxin-Free 
230900CB Chymotrypsin, Human Pancreas 
524576CB CIAP 
524572CB CIAP 
PC431CB Anti-CIDE-A 
PC432CB Anti-CIDE-A 
PC431CB Anti-CIDE-A (Ab-1) (Rabbit) 
PC431CB CIDE-A (Ab-1) Polyclonal Antibody 
PC432CB Anti-CIDE-B (Ab-1) (Rabbit) 
PC432CB CIDE-B (Ab-1) Polyclonal Antibody 
230950CB Ciglitazone 
231000CB Ciliary Neurotrophic Factor, Rat, Recombinant, E. coli 
231085CB Cilostamide 
PC55CB Anti-CIP1 
OP64CB Anti-CIP1 
OP64FCB Anti-CIP1 
OP64TCB Anti-CIP1 
OP68CB Anti-CIP1 
OP76CB Anti-CIP1 
OP79CB Anti-CIP1 
QIA18CB CIP1 ELISA 
WBB10CB CIP1 Western Blotting System 
WBB09CB CIP1 Western Blotting System, Biotinylated 
181198CB cis,cis,cis,cis-5,8,11,14-Eicosatetraenoic Acid 
181205CB cis,cis,cis,cis-5,8,11,14-Eicosatetraenoic Acid, Na 
01-64-0250CB cis-1,2-Diaminocyclohexane trityl resin 
420600CB cis-1-Acetyl-4-[4-[[2-(2,4-dichlorophenyl)-2-(1H-imidazol-1-ylmethyl)-1,3-dioxolan-4-yl]methoxy]phenyl]piperazine 
567315CB cis-9-Octadecenamide 
4954CB cis-9-Octadecenoic Acid 
232120CB cis-Diaminedichloroplatinum 
216100CB cis-Diammine[1,1-cyclobutanedicarboxylato]platinum(II) 
444200CB cis-N-(2-Phenylcyclopentyl)azacyclotridec-1-en-2-amine, HCl 
512730CB cis-Parinaric Acid 
232120CB Cisplatin 
232100CB CIT 
69297CB CITE primer 
69888CB CITE primer, 5’P 
567444CB Citric Acid, 3Na 
231211CB Citric Acid, Monohydrate, Molecular Biology Grade 
438005CB Citric Acid, 3Li 
232100CB Citrinin, Penicillium citrinium 
231246CB Anti-Citrullin (Rabbit) 
231246CB Citrullin Polyclonal Antibody 
231245CB L-Citrulline 
218700CB Anti-CK1 
218731CB CK2 substrate 
231576CB Anti-CKII Substrate, Activated 
233100CB CL-387,785 
233105CB CL-82198 
494410CB CLA 
220467CB Cladribine 
343002CB Anti-CLARP 
343006CB Anti-CLARP 
426102CB clasto-Lactacystin b-Lactone 
CP45CB Anti-Clathrin Heavy Chain (Ab-1) (Mouse) 
CP45CB Clathrin Heavy Chain (Ab-1) Monoclonal Antibody 
220545CB Clathrin, Light Chain Monoclonal Antibody 
220545CB Anti-Clathrin, Light Chain, Bovine (Mouse) 
220561CB CLC-1 Polyclonal Antibody 
220561CB Anti-CLC-1, Rat (Rabbit) 
220562CB CLC-2 (888-906) Polyclonal Antibody 
220562CB Anti-CLC-2 (888-906), Rat (Rabbit) 
220563CB CLC-3 (592-661) Polyclonal Antibody 
220563CB Anti-CLC-3 (592-661), Rat (Rabbit) 
220565CB CLC-K Polyclonal Antibody 
220565CB Anti-CLC-K, Rat (Rabbit) 
220565CB Anti-CLC-K1 
220565CB Anti-CLC-K2 
220565CB Anti-CLC-Ka 
220565CB Anti-CLC-Kb 
220561CB Anti-Clcn1 
220563CB Anti-Clcn3 
70848CB ClearSpin™ Filters 
69069CB Cleavage Control Protein 
PC516CB Anti-Cleaved PARP (Ab-1) (Rabbit) 
PC516CB Cleaved PARP (Ab-1) Polyclonal Antibody 
233152CB Cleland’s Other Reagent 
233155CB Cleland’s Reagent 
233157CB Cleland’s Reagent, Immobilized 
233156CB Cleland’s Reagent, Molecular Biology Grade 
233159CB Cleland’s Reagent, Oxidized 
233153CB Cleland’s Reagent, ULTROL® Grade 
233157CB Cleland’s REDUCTACRYL™ Reagent 
233165CB Clioquinol 
233180CB Clobenpropit, Dihydrobromide 
233170CB CLOCK (11-30) Polyclonal Antibody 
233170CB Anti-CLOCK (11-30), Human and Mouse (Rabbit) 
231405CB Clofibrate 
70573CB Clonables™ 2X Ligation Premix 
70526CB Clonables™ Ligation-Transformation Kit 
231475CB Clonidine, Hydrochloride 
233230CB Clotrimazole 
233230CB CLT 
233901CB CLZ-f 
233903CB CLZ-h 
233902CB CLZ-hcp 
233904CB CLZ-n 
512501CB CM-papain Resin 
PC422CB Anti-CMH-1 
PC334TCB CMH-1 
PC334CB Anti-CMH-1 
AM45TCB CMH-1 
APS01CB CML (Chronic Myelogenous Leukemia) Primer Set 
164590CB CMO 
475933CB cMos (149-177) Blocking Peptide, Mouse 
475931CB cMos (149-177) Polyclonal Antibody 
475931CB Anti-cMos (149-177), Mouse (Rabbit) 
233263CB CMP-b-D-Sialic Acid, Disodium Salt 
233266CB CMP-N-Acetylneuraminic Acid Synthetase 
233265CB CMP-N-Acetylneuraminic Acid Synthetase 
233263CB CMP-N-acetylneuraminic Acid, 2Na 
233263CB CMP-NANA 
233263CB CMP-Neu5Ac 
233265CB CMP-Neu5Ac Synthetase 
233266CB CMP-Neu5Ac Synthetase 
233265CB CMP-Sialic Acid Synthetase, E. coli, Recombinant, E. coli 
233266CB CMP-Sialic Acid Synthetase, Neisseria meningitidis, Recombinant, E. coli 
05-23-0310CB CNP 
C-170CB CNP (human) 
481911CB Co I 
481971CB Co II, Na 
233500CB Coagulation Factor b-XIIa Substrate, Colorimetric 
233496CB Coagulation Factor b-XIIa, Human Plasma 
233493CB Coagulation Factor a-XIIa, Human Plasma 
539515CB Coagulation Factor II 
233279CB Coagulation Factor IX, Human Plasma 
233285CB Coagulation Factor IXaa, Human Plasma 
233290CB Coagulation Factor IXab, Human Plasma 
219365CB Coagulation Factor V, Human Plasma 
219367CB Coagulation Factor VII, Human Plasma 
219370CB Coagulation Factor VIIa, Human Plasma 
233413CB Coagulation Factor VIIIc Monoclonal Antibody 
233413CB Anti-Coagulation Factor VIIIc, Human (Mouse) 
233282CB Coagulation Factor X, Human Plasma 
233526CB Coagulation Factor Xa, Human Plasma 
233480CB Coagulation Factor XI, Human Plasma 
233483CB Coagulation Factor XIa, Human Plasma 
233490CB Coagulation Factor XII, Human Plasma 
233502CB Coagulation Factor XIII, A-Subunit Polyclonal Antibody 
233502CB Anti-Coagulation Factor XIII, A-Subunit, Human Placenta (Rabbit) 
233501CB Coagulation Factor XIII, Human Plasma 
233503CB Coagulation Factor XIII, S-Subunit Polyclonal Antibody 
233550CB Cobra venom anticomplementary protein 
233552CB Cobra Venom Anticomplementary Protein 
233550CB Cobra Venom Factor, Naja naja 
233552CB Cobra Venom Factor, Naja naja kaouthia 
218388CB Cocaine- and Amphetamine-Regulated Transcript 
218387CB Cocaine- and Amphetamine-Regulated Transcript 55-102 
218300CB Anti-Cocaine- and Amphetamine-Related Transcript 
496270CB Cochliobolin A 
5440CB Codecarboxylase 
233900CB Coelenterazine 
233901CB Coelenterazine-f, Synthetic 
233903CB Coelenterazine-h, Synthetic 
233902CB Coelenterazine-hcp, Synthetic 
233904CB Coelenterazine-n, Synthetic 
203990CB Coenzyme A, N-Butyryl-, Lithium Salt 
234101CB Coenzyme A, Trilithium Salt, Dihydrate 
234108CB Coformycin, Streptomyces antibioticus 
516742CB Colaminphenolphthalein Phosphate 
234109CB Colcemid 
234115CB Colchicine, Colchicum autumnale 
344270CB Colforsin 
70845CB coliDOWN primer 
71013CB ColiRollers™ Plating Beads 
ASK19CB Collagen Antibody Sampler Kit I 
CP17LCB Anti-Collagen Type I (Ab-1) (Mouse) 
CP17LCB Collagen Type I (Ab-1) Monoclonal Antibody 
CP18LCB Anti-Collagen Type II (Ab-1) (Mouse) 
CP18LCB Collagen Type II (Ab-1) Monoclonal Antibody 
CP19LCB Anti-Collagen Type III (Ab-1) (Mouse) 
CP19LCB Collagen Type III (Ab-1) Monoclonal Antibody 
CP20LCB Anti-Collagen Type IV (Ab-1) (Mouse) 
CP20LCB Collagen Type IV (Ab-1) Monoclonal Antibody 
CP56CB Anti-Collagen Type IV (Ab-2) (Mouse) 
CP56CB Collagen Type IV (Ab-2) Monoclonal Antibody 
234112CB Collagen, Calf Skin 
234167CB Collagen, Type I Polyclonal Antibody 
234137CB Collagen, Type I, Bovine Achilles Tendon, Fluorescein Conjugate 
234168CB Anti-Collagen, Type I, Cyanogen Bromide Fragments, Fetal Mouse Skin (Rabbit) 
234167CB Anti-Collagen, Type I, Fetal Mouse Skin (Rabbit) 
234149CB Collagen, Type I, Human Placenta 
234138CB Collagen, Type I, Human Skin 
234169CB Collagen, Type I-III, Cyanogen Bromide Fragments Polyclonal Antibody 
234169CB Anti-Collagen, Type I-III, Cyanogen Bromide Fragments, Fetal Mouse Skin (Rabbit) 
234183CB Collagen, Type II , Cyanogen Bromide Fragments Polyclonal Antibody 
234183CB Anti-Collagen, Type II , Cyanogen Bromide Fragments, Mouse Chondrosarcoma (Rabbit) 
234187CB Collagen, Type II Polyclonal Antibody 
234184CB Collagen, Type II, Bovine Joint Cartilage 
234188CB Collagen, Type II, Cyanogen Bromide Fragments Polyclonal Antibody 
234188CB Anti-Collagen, Type II, Cyanogen Bromide Fragments, Rat Chondrosarcoma (Rabbit) 
234186CB Collagen, Type II, Mouse Sternum Cartilage 
234187CB Anti-Collagen, Type II, Rat Chondrosarcoma (Rabbit) 
234189CB Collagen, Type III, Cyanogen Bromide Fragments Polyclonal Antibody 
234189CB Anti-Collagen, Type III, Cyanogen Bromide Fragments, Fetal Mouse Skin (Rabbit) 
234154CB Collagen, Type IV, Human Placenta 
234194CB Collagen, Type IX Polyclonal Antibody 
234143CB Anti-Collagen, Type IX, a1-Subunit-Specific, Human (Rabbit) 
234144CB Collagen, Type IX, a2-Subunit Specific Polyclonal Antibody 
234144CB Anti-Collagen, Type IX, a2-Subunit Specific, Human (Rabbit) 
234146CB Collagen, Type IX, a3-Subunit Specific Polyclonal Antibody 
234146CB Anti-Collagen, Type IX, a3-Subunit Specific, Human (Rabbit) 
234194CB Anti-Collagen, Type IX, Rat Chondrosarcoma (Rabbit) 
234195CB Collagen, Type IX-XI Polyclonal Antibody 
234195CB Anti-Collagen, Type IX-XI, Rat Chondrosarcoma (Rabbit) 
234190CB Collagen, Type V Polyclonal Antibody 
234161CB Collagen, Type V, Human Placenta 
234190CB Anti-Collagen, Type V, Human Placenta (Rabbit) 
234191CB Collagen, Type VI Polyclonal Antibody 
234191CB Anti-Collagen, Type VI, Human Placenta (Rabbit) 
234192CB Collagen, Type VII Polyclonal Antibody 
234192CB Anti-Collagen, Type VII, Human Placenta (Rabbit) 
234196CB Collagen, Type X Polyclonal Antibody 
444231CB 92 kDa Type IV Collagenase 
234136CB Collagenase Affinity Ligand 
234140CB Collagenase Inhibitor I 
234141CB Collagenase Inhibitor II, Dipotassium Salt 
317475CB Collagenase Substrate I 
234147CB Collagenase Substrate II 
234164CB Collagenase Substrate III, Fluorogenic 
444227CB Collagenase Type IV 
IM09LCB Anti-Type IV Collagenase 
234133CB Collagenase, Paralithodes camtschatica Hepatopancreas 
234153CB Collagenase, Type I, Clostridium histolyticum 
234134CB Collagenase, Type III, Clostridium histolyticum 
IM61CB Anti-Type IV Collagenase 
IM61TCB Anti-Type IV Collagenase 
444208CB Collagenase-1 
444229CB Collagenase-2 
IM64LCB Anti-Collagenase-3 
IM64TCB Anti-Collagenase-3 
IM78CB Anti-Collagenase-3 
IM79CB Anti-Collagenase-3 
IM80CB Anti-Collagenase-3 
IM81CB Anti-Collagenase-3 
IM44LCB Anti-Collagenase-3 
IM44TCB Anti-Collagenase-3 
PC326CB Anti-Collagenase-3 
PC542TCB Collagenase-3 
PC542CB Anti-Collagenase-3 
IM78TCB Anti-Collagenase-3 
444235CB Collagenase-3 Substrate, Fluorogenic 
385893CB Colligin 
386023CB Anti-Colligin 
GR12LCB Anti-Colony Stimulating Factor 
GR04LCB Anti-Colony Stimulating Factor 
69283CB ColonyFinder® Kit 
234205CB Column Protein Concentrate™ Kit 
324762CB Common Acute Lymphocytic Antigen 
474700CB Compactin 
234395CB Complement, Guinea Pig Serum 
234400CB Complement, Rabbit Serum 
219445CB Compound 3 
234490CB Compound 32 
234500CB Compound 48-80, Trihydrochloride 
234450CB Compound 5 
234455CB Compound 5, Methyl Ester 
234503CB Compound 52 
234505CB Compound 56 
208665CB Compound R 24571 
234567CB Con A 
343235CB Con A, FITC-labeled 
234568CB Con A-agarose 
234569CB Con A-agarose Set 
234520CB Conalbumin, Egg 
234550CB Conantokin G, Conus geographus 
234555CB Conantokin T, Conus tulipa 
344085CB Concanamycin A 
234590CB Concanavalin A Plate, Clear Polystyrene 
234592CB Concanavalin A Plate, Opaque White Polystyrene 
234594CB Concanavalin A Strips, Clear Polystyrene 
234596CB Concanavalin A Strips, Opaque White Polystyrene 
234567CB Concanavalin A, Canavalia ensiformis 
234568CB Concanavalin A, Canavalia ensiformis, Agarose Conjugate 
234569CB Concanavalin A, Canavalia ensiformis, Agarose Conjugate Set 
343235CB Concanavalin A, Canavalia ensiformis, Fluorescein-Labeled 
234599CB Conduritol B Epoxide 
234610CB Congo Red, High Purity 
480676CB Congocidine 
494410CB 9-cis,11-trans-Conjugated Linoleic Acid 
234612CB Conopressin G, Conus geographus 
234617CB Conopressin S, Conus striatus 
341010CB Contaminant 97 
69330CB Red Nova Lysate Control RNA 
69716CB SureSite II System Control Slides (mouse testis) 
HC04CB Control Slides - Human Breast Carcinoma 
HC05CB Control Slides - Human Colon Carcinoma 
HC06CB Control Slides - Human Normal Skin 
219367CB Convertin 
234850CB Copper Diisopropylsalicylate 
234850CB Copper(II)bis-3,5-diisopropylsalicylate 
235200CB Corticosteroid-Binding Globulin, Human Serum 
235135CB Corticosterone 
NB18CB Anti-Corticotropin 
PC208LCB Anti-Corticotropin Releasing Factor (Ab-1) (Rabbit) 
PC208LCB Corticotropin Releasing Factor (Ab-1) Polyclonal Antibody 
05-23-0050CB Corticotropin-Releasing Factor, Human and Rat 
3867CB Cortisol 
475887CB Corvaton 
235261CB COT, N-Terminal (1-15) Blocking Peptide, Human 
235260CB COT, N-Terminal (1-15) Polyclonal Antibody 
235260CB Anti-COT, N-Terminal (1-15), Human (Rabbit) 
164545CB Coumarin 120 
164580CB Coumarin 151 
235265CB Coumermycin A1 
236000CB Anti-COX-1 (Rabbit) 
236000CB COX-1 Polyclonal Antibody 
538950CB COX-2 
236002CB Anti-COX-2 (Rabbit) 
236010CB COX-2 Inhibitor, PTPBS 
236002CB COX-2 Polyclonal Antibody 
444272CB CP 
527993CB CP-16171 
529610CB Cp-60 
529615CB Cp-62 
317220CB CP20 
239785CB CPA 
239805CB CPA 
205543CB Anti-CPAN 
PC412CB Anti-CPAN 
234452CB Cpd 5 
232120CB CPDC 
539507CB Anti-cPKC 
197220CB cpm-1285 
218830CB cpm-VAD-CHO 
454150CB CPMT 
220198CB Anti-Cpn10 
235417CB CPP32 
AM65CB Anti-CPP32 
AM34CB Anti-CPP32 
AM34TCB Anti-CPP32 
AM20CB Anti-CPP32 
AM20TCB Anti-CPP32 
AM39TCB Anti-CPP32 
AM39CB Anti-CPP32 
WBB27CB CPP32 Biotinylated Western Blotting System 
235420CB CPP32-apopain Inhibitor 
235422CB CPP32-Apopain Inhibitor, Biotin Conjugate 
235423CB CPP32-Apopain Inhibitor, Cell-permeable 
235410CB CPPG 
220588CB CPRG, Na 
217642CB Anti-CR3 
217643CB Anti-CR3, FITC 
217644CB Anti-CR4 
217645CB Anti-CR4, FITC 
553196CB Anti-CRADD (Caspase and RIP Adapter with Death Domain) 
553198CB Anti-CRADD (Caspase and RIP Adapter with Death Domain) 
PC395CB Anti-CRADD (Caspase and RIP Adapter with Death Domain) 
PC395TCB Anti-CRADD (Caspase and RIP Adapter with Death Domain) 
PC370CB Anti-CRAF-1 
69247CB Cre Recombinase 
237911CB Creatine Phosphate, Dipotassium Salt 
2380CB Creatine Phosphate, Disodium Salt 
238395CB Creatine Phosphokinase, Porcine Heart 
2384CB Creatine Phosphokinase, Rabbit Skeletal Muscle 
238397CB Creatine Phosphokinase-BB Isoenzyme, Human Brain 
238399CB Creatine Phosphokinase-MB Isoenzyme, Human Heart 
238407CB Creatine Phosphokinase-MM Isoenzyme, Human Skeletal Muscle 
238409CB Creatine Phosphokinase-MM Isoenzyme, Human, Recombinant, Pichia pastoris 
238454CB Creatinine, Reference Standard 
238461CB CREB Polyclonal Antibody 
238461CB Anti-CREB, Human (Rabbit) 
PC455CB Anti-CREB, Phospho-Specific (Ab-1) (Rabbit) 
PC455CB CREB, Phospho-Specific (Ab-1) Polyclonal Antibody 
238462CB CREB, Phospho-Specific Polyclonal Antibody 
238462CB Anti-CREB, Phospho-Specific, Human (Rabbit) 
238464CB CREBtide 
PC208LCB Anti-CRF 
05-23-0050CB CRF 
C-110CB CRF (human) 
C-111CB CRF (human) 
05-23-0070CB CRF Antagonist 
C-S-037CB CRF-Antagonist (9-41) 
05-23-1701CB CRGDSPASSC, Cyclic 
CC23LCB Anti-CRK2 
CC22LCB Anti-CRK2 
238476CB Crotoxin, A-Subunit, Crotalus durissus terrificus 
238477CB Crotoxin, B-Subunit, Crotalus durissus terrificus 
236603CB CRP 
236600CB CRP 
235752CB Anti-CRP 
208902CB CS Peptide 
PC483CB Anti-CSD1 
GR12LCB Anti-CSF-1 Receptor -c-fms (Ab-2) (Rat) 
GR12LCB CSF-1 Receptor -c-fms (Ab-2) Monoclonal Antibody 
GR04LCB Anti-CSF-1 Receptor-c-fms (Ab-1) (Rat) 
GR04LCB CSF-1 Receptor-c-fms (Ab-1) Monoclonal Antibody 
217705CB CSH 103 
243015CB Anti-CSP 
238476CB CT-A 
238477CB CT-B 
219374CB CTAB 
529595CB 5'-CTCTGTCATTGGAGCAGC-3' 
218120CB Anti-CTLA-4 
217690CB CTLA-4 muIg Fusion Protein 
574594CB Cu-Zn SOD 
428033CB Cu2+-Oxidized Low Density Lipoprotein Polyclonal Antibody 
234850CB CuDIPS 
197203CB 5'-2'-OMe(CUGGAUCCAAGGCUGUAGGU)-3' 
197205CB 5'-2'-OMe(CUGGUUACACGACUCCAGGU)-3' 
PC441CB Anti-Cullin-1 (CUL-1) (Ab-1) (Rabbit) 
PC441CB Cullin-1 (CUL-1) (Ab-1) Polyclonal Antibody 
PC442CB Anti-Cullin-2 (CUL-2) (Ab-1) (Rabbit) 
PC442CB Cullin-2 (CUL-2) (Ab-1) Polyclonal Antibody 
239802CB Curcumin, Curcuma longa L. 
PC443CB Anti-CX3C Chemokine Receptor 1 
PC443CB Anti-CX3CR1 (Ab-1) (Rabbit) 
PC443CB CX3CR1 (Ab-1) Polyclonal Antibody 
344950CB Anti-CXCR-4 
344951CB Anti-CXCR4 
PC389CB Anti-CXCR4 (Ab-1) (Rabbit) 
PC389CB CXCR4 (Ab-1) Polyclonal Antibody 
PC390CB Anti-CXCR4 (Ab-2) (Rabbit) 
PC390CB CXCR4 (Ab-2) Polyclonal Antibody 
119505CB CyaA 
121760CB a-Cyano-(3,4-dihydroxy)cinnamic Acid 
658402CB a-Cyano-(-)-(R)-N-(a-phenethyl)-3,4-dihydroxycinnamide 
01-64-0313CB Cyanoacetic acid Wang resin 
6791CB Cyanocobalamin 
365250CB 12-(2-Cyanoethyl)-6,7,12,13-tetrahydro-13-methyl-5-oxo-5H-indolo(2,3-a)pyrrolo(3,4-c)-carbazole 
658417CB a-Cyano-(3-methoxy,4-hydroxy,5-iodo)cinnamoyl-(3',4'-dihydroxyphenyl)ketone 
239100CB Cyclic Adenosine Diphosphate-ribose 
239100CB Cyclic ADP-Ribose 
239100CB Cyclic ADPR 
370656CB Cyclic GMP 
3542CB Cyclic(g-Glu-Cys-Gly)2 
CC02CB Anti-Cyclin A (Ab-2) (Mouse) 
CC02CB Cyclin A (Ab-2) Monoclonal Antibody 
CC17CB Anti-Cyclin A (Ab-3) (Mouse) 
CC17FCB Anti-Cyclin A (Ab-3) (Mouse) Fluorescein Conjugate 
CC17CB Cyclin A (Ab-3) Monoclonal Antibody 
CC17FCB Cyclin A (Ab-3) Monoclonal Antibody Fluorescein Conjugate 
CC18LCB Cyclin A (Ab-4) Monoclonal Antibody 
PC132CB Anti-Cyclin A (Ab-5) (Rabbit) 
PC132CB Cyclin A (Ab-5) Polyclonal Antibody 
CC03CB Anti-Cyclin B1 (Ab-2) (Mouse) 
CC03CB Cyclin B1 (Ab-2) Monoclonal Antibody 
PC133CB Anti-Cyclin B1 (Ab-3) (Rabbit) 
PC133CB Cyclin B1 (Ab-3) Polyclonal Antibody 
PC440CB Anti-Cyclin C (Ab-1) (Rabbit) 
PC440CB Cyclin C (Ab-1) Polyclonal Antibody 
PC477CB Anti-Cyclin C (Ab-2) (Rabbit) 
PC477CB Cyclin C (Ab-2) Polyclonal Antibody 
CC04CB Anti-Cyclin D1 (Ab-1) (Rat) 
CC04CB Cyclin D1 (Ab-1) Monoclonal Antibody 
CC11CB Anti-Cyclin D1 (Ab-2) (Mouse) 
CC11CB Cyclin D1 (Ab-2) Monoclonal Antibody 
CC12CB Anti-Cyclin D1 (Ab-3) (Mouse) 
CC12FCB Anti-Cyclin D1 (Ab-3) (Mouse) Fluorescein Conjugate 
CC12CB Cyclin D1 (Ab-3) Monoclonal Antibody 
CC12FCB Cyclin D1 (Ab-3) Monoclonal Antibody Fluorescein Conjugate 
CC07CB Anti-Cyclin D2 (Ab-1) (Rat) 
CC07CB Cyclin D2 (Ab-1) Monoclonal Antibody 
CC08LCB Anti-Cyclin D3 (Ab-1) (Rat) 
CC08LCB Cyclin D3 (Ab-1) Monoclonal Antibody 
CC13CB Anti-Cyclin D3 (Ab-2) (Mouse) 
CC13CB Cyclin D3 (Ab-2) Monoclonal Antibody 
238810CB Cyclin D3 Monoclonal Antibody 
CC05CB Anti-Cyclin E (Ab-1) (Mouse) 
CC05CB Cyclin E (Ab-1) Monoclonal Antibody 
PC135CB Anti-Cyclin E (Ab-2) (Rabbit) 
PC135CB Cyclin E (Ab-2) Polyclonal Antibody 
PC438CB Anti-Cyclin E (Ab-3) (Rabbit) 
PC438CB Cyclin E (Ab-3) Polyclonal Antibody 
PC439CB Anti-Cyclin E2 (Ab-1) (Rabbit) 
PC439CB Cyclin E2 (Ab-1) Polyclonal Antibody 
PC468CB Anti-Cyclin F (Ab-1) (Rabbit) 
PC468CB Cyclin F (Ab-1) Polyclonal Antibody 
PC375CB Anti-Cyclin G1 (Ab-1) (Rabbit) 
PC375TCB Anti-Cyclin G1 (Ab-1) (Rabbit) 
PC375TCB Cyclin G1 (Ab-1) Polyclonal Antibody 
PC375CB Cyclin G1 (Ab-1) Polyclonal Antibody 
PC531CB Anti-Cyclin H (Ab-1) (Rabbit) 
PC531CB Cyclin H (Ab-1) Polyclonal Antibody 
PC479CB Anti-Cyclin I (Ab-1) (Rabbit) 
PC479CB Cyclin I (Ab-1) Polyclonal Antibody 
219443CB Anti-Cyclin-Dependent Protein Kinase 2 
219446CB Anti-Cyclin-Dependent Protein Kinase 4 
PC45CB Anti-Cyclin-Dependent Protein Kinase 4 
CC19LCB Anti-Cyclin-Dependent Protein Kinase 4 
CC21LCB Anti-Cyclin-Dependent Protein Kinase 4 
CC20LCB Anti-Cyclin-Dependent Protein Kinase 4 
219449CB Anti-Cyclin-Dependent Protein Kinase 5 
219452CB Anti-Cyclin-Dependent Protein Kinase 6 
217704CB Anti-Cyclin-Dependent Protein Kinase 8 
219428CB Cyclin-Dependent Protein Kinase Inhibitor Set 
C-027CB Cyclo (D-Asp-Pro-D-Val-Leu-D-Trp) · Na 
182015CB Cyclo(Arg-Gly-Asp-D-Phe-Val) 
178276CB cyclo-[L-(2-Amino-8-oxodecanoyl)-L-(N-methoxytryptophan)-L-isoleucyl-D-pipecolinyl 
373205CB Cyclo-(D-Pro-L-Ala-D-Ala-L-2-amino-8-oxo-9,10-epoxydecanoic Acid) 
182020CB Cyclo[Asp(OBz)-D-Phe-MeVal-Arg(Mtr)-Gly] 
239760CB Cycloheptaamylose 
239758CB Cyclohexaamylose 
239763CB Cycloheximide 
239764CB Cycloheximide, High Purity 
239770CB Cycloheximide-N-(Ethyl Ethanoate) 
239776CB Cyclohexyl-methyl-b-D-maltoside, ULTROL® Grade 
239774CB Cyclohexyl-n-ethyl-b-D-maltoside, ULTROL® Grade 
239775CB Cyclohexyl-n-hexyl-b-D-maltoside, ULTROL® Grade 
231085CB N-Cyclohexyl-N-methyl-4-(1,2-dihydro-2-oxo-6-quinolyloxy)butyramide 
239782CB 3-(Cyclohexylamino)propanesulfonic Acid 
349254CB N-(2-Cyclohexyloxy-4-nitrophenyl)methanesulfonamide 
239758CB Cyclomaltohexose 
239762CB Cyclooctaamylose 
239762CB Cyclooctaose 
239789CB Cyclooxygenase Activity Kit, Chemiluminescent 
239783CB Cyclooxygenase Inhibitor Set 
236000CB Anti-Cyclooxygenase-1 
236002CB Anti-Cyclooxygenase-2 
538950CB Cyclooxygenase-2 
239780CB Cyclophilin 40 Polyclonal Antibody 
239781CB Cyclophilin 40, C-Terminal (356-370) Polyclonal Antibody 
239781CB Anti-Cyclophilin 40, C-Terminal (356-370), Human (Rabbit) 
239780CB Anti-Cyclophilin 40, Human (Rabbit) 
239778CB Cyclophilin A Polyclonal Antibody 
239778CB Anti-Cyclophilin A, Human (Rabbit) 
239777CB Cyclophilin A, Human, Recombinant, E. coli 
239784CB Cyclophilin D (42-54) Polyclonal Antibody 
239785CB Cyclophosphamide Monohydrate 
239805CB Cyclopiazonic Acid, Penicillium cyclopium 
239831CB D-Cycloserine 
239835CB Cyclosporin A, Tolypocladium inflatum 
239845CB Cyclothiazide 
205401CB Cyfra 21-1 
239900CB Cypermethrin 
243005CB Cys 
2430CB Cys, HCI 
344512CB H-Cys-4-Abz-Met-OH 
240893CB Cystatin A, Human Placenta 
240896CB Cystatin C, Human Urine 
240891CB Cystatin, Egg White 
01-64-0107CB Cysteamine 2-chlorotrityl resin 
01-64-0086CB Cysteamine 4-methoxytrityl resin 
01-64-0180CB Cysteamine methyl polystyrene (200 - 400 mesh) 
243015CB Cysteine String Protein (182-198) Polyclonal Antibody 
243015CB Anti-Cysteine String Protein (182-198), Rat (Rabbit) 
243005CB L-Cysteine, Free Base 
2430CB L-Cysteine, Hydrochloride 
2470CB L-Cystine 
251010CB Cytarabine 
205401CB Cyto-19 
71009CB CytoBuster Protein Extraction Reagent 
250230CB Cytochalasin A 
250225CB Cytochalasin B, Dihydro- 
250233CB Cytochalasin B, Helminthosporium dematioideum 
250255CB Cytochalasin D, Zygosporium mansonii 
250234CB Cytochalasin E, Aspergillus clavatus 
250240CB Cytochalasin Sampler Set 
250301CB Cytochrome b5, Human, Recombinant, E. coli 
PC323CB Anti-Cytochrome c (Ab-1) (Sheep) 
PC323CB Cytochrome c (Ab-1) Polyclonal Antibody 
PC333CB Anti-Cytochrome c (Ab-2) (Rabbit) 
PC333TCB Anti-Cytochrome c (Ab-2) (Rabbit) 
PC333TCB Cytochrome c (Ab-2) Polyclonal Antibody 
PC333CB Cytochrome c (Ab-2) Polyclonal Antibody 
QIA74CB Cytochrome c ELISA Kit 
QIA87CB Cytochrome c Release Apoptosis Assay Kit 
250600CB Cytochrome c, Equine Heart 
250302CB Cytochrome P450 1A1 Monoclonal Antibody 
250303CB Cytochrome P450 2B6 Monoclonal Antibody 
250303CB Anti-Cytochrome P450 2B6, Human (Mouse) 
250304CB Cytochrome P450 2C8-9-18-19 Monoclonal Antibody 
250304CB Anti-Cytochrome P450 2C8-9-18-19, Human (Mouse) 
250309CB Cytochrome P450 2D6 Monoclonal Antibody 
250309CB Anti-Cytochrome P450 2D6, Human (Mouse) 
250310CB Cytochrome P450 2D6i Monoclonal Antibody 
250310CB Anti-Cytochrome P450 2D6i, Human (Mouse) 
250306CB Anti-Cytochrome P450 2E1, Human (Rabbit) 
250305CB Cytochrome P450 2E1, Human, Recombinant, E. coli 
250308CB Cytochrome P450 3A4 Polyclonal Antibody 
250308CB Anti-Cytochrome P450 3A4, Human (Rabbit) 
250307CB Cytochrome P450 3A4, Human, Recombinant, E. coli 
IF09LCB Anti-Cytokeratin (Ab-2) (Mouse) 
IF09LCB Cytokeratin (Ab-2) Monoclonal Antibody 
IF14CB Anti-Cytokeratin 18 (Ab-2) (Mouse) 
IF14CB Cytokeratin 18 (Ab-2) Monoclonal Antibody 
IF15CB Anti-Cytokeratin 19 (Ab-1) (Mouse) 
IF15CB Cytokeratin 19 (Ab-1) Monoclonal Antibody 
205401CB Cytokeratin 19 Antigen, Cyfra 21-1, Cell Culture-Derived 
IF13CB Anti-Cytokeratin 8 (Ab-1) (Mouse) 
IF13CB Cytokeratin 8 (Ab-1) Monoclonal Antibody 
CP68CB Anti-Cytokeratin Cocktail (Ab-4) (Mouse) 
CP68CB Cytokeratin Cocktail (Ab-4) Monoclonal Antibody 
251010CB Cytosine Arabinoside 
QIA88CB Cytosol-Mitochondria Fractionation Kit 
616377CB Cytotoxin 

Is your biochemical not listed? Click on the first letter of your biochemical below:

A B C D E F G H I J K L M N O P Q R S T U V W X Y Z

Our Product Categories Include:
Affinity Chromatography
Alzheimer's Disease Related Products
Amino Acids and Amino Acid Analogs
Angiogenesis
Anti-Inflammatory Agents
Anti-Malarial Agents
Antibiotics
Antibodies
Antifungal Agents
Antiprotozoal Agents
Antiviral Agents
Apoptosis and Related Tools
BacVector Transfection Components
Bioactive Compounds for Clinical Research
Bioactive Lipids
Biochemicals
Buffers
Building blocks for solid phase synthesis
Calcium Signaling Tools
Cancer/Cell Cycle Research
Cell Adhesion Molecules
Cell Pellets/Extracts & Tissue Extracts
Cloning
Condensation reagents & linkers
Creatine, Creatine Phosphates and Phosphokinases
Cross-linkers
Detergents
Dialysis Tools
Dyes, Stains, and Probes
Electrophoresis and Gel Staining Reagents
ELISA
Enzyme
Enzyme Activators
Fusion Tag Detection
G-Proteins and Related Tools
Gene & Protein Analysis
Glycobiology
Growth Factors, Cytokines, & Hormones
HT Compatibles
HTS
IHC Detection
Immunochemicals
Immunomodulators and Related Products
Ionophores
Kits and Sets
Lipids, Fatty Acids, Phospholipids, and Related Products
Matrix Metalloproteinases (MMPs)
Molecular Biology
Molecular Biology Tools
Molecular Size Markers
Molecular Weight Markers
Neurochemicals
Nitric Oxide (NO) Research Tools
Nucleic Acid Purification
Nucleotides, Nucleosides, Bases, and Related Products
Organics and Inorganics
Other Signal Transduction Products
Oxidative Stress / Free Radicals
PCR
Phage Display
Plant Biology Tools
Pre-loaded resins
Protease Inhibitors
Proteases
Protein Concentration Tools
Protein Expression
Protein Kinases
Protein Modifying Reagents
Protein Phosphatases
Protein Purification
Protein Synthesis Inhibitors
Proteins
Purification Tools
Resins for solid phase organic chemistry
Resins for solid phase peptide synthesis
Resins for solution phase organic chemistry
Second Messengers
Secondary Antibodies
Sera & IgG
Substrates
Support Products
Topoisomerase Inhibitors
Transcription/Translation
Transformation/Transfection
Trial Size Antibodies
Ubiquitin/Proteasome Pathway
Vectors
Vitamins, Coenzymes, and Related Products
Western Blotting Detection Systems & Standards